Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420896565:

Variant ID: vg0420896565 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 20896565
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.67, T: 0.33, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


TTATAAGCCAGAAAGTGGTTAGAGCCTCGCTACGCCCTTTATAAGCCAGGGCATGGCTGACACTATTTTGGTTACGGTGAATCTTCATGATAACAATATC[T/C]
CTATTCCCAGCCATGAGGTGCCAATATCCCTATTCCCAACCATGAGGTGCTTTATCTCCCTAGCTAGGAAAACTAGCTCTGATCGTTCCTCCTCCTTTGA

Reverse complement sequence

TCAAAGGAGGAGGAACGATCAGAGCTAGTTTTCCTAGCTAGGGAGATAAAGCACCTCATGGTTGGGAATAGGGATATTGGCACCTCATGGCTGGGAATAG[A/G]
GATATTGTTATCATGAAGATTCACCGTAACCAAAATAGTGTCAGCCATGCCCTGGCTTATAAAGGGCGTAGCGAGGCTCTAACCACTTTCTGGCTTATAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.40% 2.10% 2.69% 0.80% NA
All Indica  2759 91.60% 3.00% 3.99% 1.38% NA
All Japonica  1512 99.50% 0.40% 0.13% 0.00% NA
Aus  269 91.80% 2.60% 5.58% 0.00% NA
Indica I  595 86.10% 3.50% 10.42% 0.00% NA
Indica II  465 93.10% 1.70% 2.80% 2.37% NA
Indica III  913 94.60% 2.80% 0.88% 1.64% NA
Indica Intermediate  786 91.50% 3.60% 3.44% 1.53% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 0.40% 0.83% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0420896565 T -> C LOC_Os04g34520.1 upstream_gene_variant ; 2261.0bp to feature; MODIFIER silent_mutation Average:79.642; most accessible tissue: Callus, score: 94.677 N N N N
vg0420896565 T -> C LOC_Os04g34530.1 upstream_gene_variant ; 1000.0bp to feature; MODIFIER silent_mutation Average:79.642; most accessible tissue: Callus, score: 94.677 N N N N
vg0420896565 T -> C LOC_Os04g34530.2 upstream_gene_variant ; 1000.0bp to feature; MODIFIER silent_mutation Average:79.642; most accessible tissue: Callus, score: 94.677 N N N N
vg0420896565 T -> C LOC_Os04g34510.1 downstream_gene_variant ; 3706.0bp to feature; MODIFIER silent_mutation Average:79.642; most accessible tissue: Callus, score: 94.677 N N N N
vg0420896565 T -> C LOC_Os04g34520-LOC_Os04g34530 intergenic_region ; MODIFIER silent_mutation Average:79.642; most accessible tissue: Callus, score: 94.677 N N N N
vg0420896565 T -> DEL N N silent_mutation Average:79.642; most accessible tissue: Callus, score: 94.677 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0420896565 T C -0.03 0.01 0.0 0.02 -0.03 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0420896565 NA 1.66E-16 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420896565 NA 8.65E-17 mr1143 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420896565 NA 1.04E-16 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420896565 NA 5.77E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420896565 NA 7.79E-06 mr1269 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420896565 NA 7.71E-09 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420896565 NA 1.15E-07 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420896565 NA 7.28E-16 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420896565 NA 6.01E-16 mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420896565 NA 2.01E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420896565 NA 2.69E-07 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420896565 NA 1.44E-06 mr1695 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420896565 NA 3.81E-24 mr1698 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420896565 NA 4.80E-14 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420896565 NA 3.37E-06 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420896565 NA 2.97E-15 mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420896565 NA 5.59E-07 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420896565 NA 5.48E-17 mr1995 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420896565 NA 1.59E-06 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420896565 NA 1.90E-08 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420896565 NA 1.85E-23 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251