\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420880180:

Variant ID: vg0420880180 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 20880180
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


GAGGTGGTAATAATGTGTGATTAATTAAGTTTTAATTATTACAAACTTGAAAAACGGATTGATTTGATAGTTTAGAACAACTTTCATATAGAAAGTTTTT[G/A]
CACGAAACGTACCGTTTAGCAGTTTGAAAAGCGTGCCACGAGTATCCAAAATTTAATCCAAAAGTTGTTGGAGAAAAGAACATGGCCTATATATAACTAT

Reverse complement sequence

ATAGTTATATATAGGCCATGTTCTTTTCTCCAACAACTTTTGGATTAAATTTTGGATACTCGTGGCACGCTTTTCAAACTGCTAAACGGTACGTTTCGTG[C/T]
AAAAACTTTCTATATGAAAGTTGTTCTAAACTATCAAATCAATCCGTTTTTCAAGTTTGTAATAATTAAAACTTAATTAATCACACATTATTACCACCTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.40% 48.40% 0.19% 0.00% NA
All Indica  2759 18.00% 81.80% 0.22% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 5.40% 94.50% 0.17% 0.00% NA
Indica II  465 12.50% 87.30% 0.22% 0.00% NA
Indica III  913 24.60% 75.40% 0.00% 0.00% NA
Indica Intermediate  786 23.20% 76.30% 0.51% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 75.60% 21.10% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0420880180 G -> A LOC_Os04g34460.1 downstream_gene_variant ; 3810.0bp to feature; MODIFIER silent_mutation Average:46.031; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg0420880180 G -> A LOC_Os04g34470.1 downstream_gene_variant ; 2486.0bp to feature; MODIFIER silent_mutation Average:46.031; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg0420880180 G -> A LOC_Os04g34480.1 downstream_gene_variant ; 606.0bp to feature; MODIFIER silent_mutation Average:46.031; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg0420880180 G -> A LOC_Os04g34490.1 downstream_gene_variant ; 2097.0bp to feature; MODIFIER silent_mutation Average:46.031; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg0420880180 G -> A LOC_Os04g34470-LOC_Os04g34480 intergenic_region ; MODIFIER silent_mutation Average:46.031; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0420880180 NA 1.87E-29 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420880180 4.58E-06 NA mr1210 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420880180 NA 4.77E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420880180 NA 1.94E-09 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420880180 NA 6.37E-20 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420880180 NA 1.45E-13 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420880180 NA 1.08E-13 mr1655 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420880180 NA 1.66E-07 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420880180 NA 5.12E-07 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420880180 NA 4.73E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420880180 NA 1.66E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420880180 NA 1.91E-15 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420880180 NA 4.04E-08 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420880180 NA 8.06E-38 mr1208_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420880180 NA 2.47E-23 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251