\
| Variant ID: vg0420839554 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 20839554 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, T: 0.26, others allele: 0.00, population size: 72. )
AGGTGAAAGAAATGATCAAAAGAGAAAGGAGAACTTTGCCAACCCAAAGCATCGCTAATAACACACCATTTGCTGCAGATCAACTGGAGATAATATGTTG[C/T]
GAATCCTCCAGCACTTGCATAGCATGCAATGTTCTGAACCCTCCTAATTTCTTTTTTTTTTCAATTGTACAGCAGACTGGATTCTATCTCTACTAGCCAA
TTGGCTAGTAGAGATAGAATCCAGTCTGCTGTACAATTGAAAAAAAAAAGAAATTAGGAGGGTTCAGAACATTGCATGCTATGCAAGTGCTGGAGGATTC[G/A]
CAACATATTATCTCCAGTTGATCTGCAGCAAATGGTGTGTTATTAGCGATGCTTTGGGTTGGCAAAGTTCTCCTTTCTCTTTTGATCATTTCTTTCACCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 30.90% | 0.90% | 0.78% | 67.46% | NA |
| All Indica | 2759 | 6.90% | 1.20% | 1.09% | 90.90% | NA |
| All Japonica | 1512 | 64.20% | 0.40% | 0.40% | 35.05% | NA |
| Aus | 269 | 77.00% | 0.00% | 0.00% | 23.05% | NA |
| Indica I | 595 | 0.80% | 0.20% | 1.51% | 97.48% | NA |
| Indica II | 465 | 4.90% | 1.10% | 1.72% | 92.26% | NA |
| Indica III | 913 | 8.30% | 0.70% | 0.88% | 90.14% | NA |
| Indica Intermediate | 786 | 10.80% | 2.50% | 0.64% | 86.01% | NA |
| Temperate Japonica | 767 | 81.90% | 0.40% | 0.26% | 17.47% | NA |
| Tropical Japonica | 504 | 35.90% | 0.60% | 0.79% | 62.70% | NA |
| Japonica Intermediate | 241 | 66.80% | 0.00% | 0.00% | 33.20% | NA |
| VI/Aromatic | 96 | 54.20% | 0.00% | 0.00% | 45.83% | NA |
| Intermediate | 90 | 46.70% | 3.30% | 1.11% | 48.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0420839554 | C -> DEL | N | N | silent_mutation | Average:44.476; most accessible tissue: Callus, score: 76.365 | N | N | N | N |
| vg0420839554 | C -> T | LOC_Os04g34420.1 | upstream_gene_variant ; 3702.0bp to feature; MODIFIER | silent_mutation | Average:44.476; most accessible tissue: Callus, score: 76.365 | N | N | N | N |
| vg0420839554 | C -> T | LOC_Os04g34410.1 | downstream_gene_variant ; 1450.0bp to feature; MODIFIER | silent_mutation | Average:44.476; most accessible tissue: Callus, score: 76.365 | N | N | N | N |
| vg0420839554 | C -> T | LOC_Os04g34410-LOC_Os04g34420 | intergenic_region ; MODIFIER | silent_mutation | Average:44.476; most accessible tissue: Callus, score: 76.365 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0420839554 | NA | 1.92E-13 | mr1013 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 2.31E-07 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 1.93E-13 | mr1031 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 3.17E-12 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 6.11E-06 | mr1046 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 3.47E-09 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 4.22E-14 | mr1056 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | 7.36E-06 | NA | mr1059 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 5.07E-07 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 1.56E-17 | mr1147 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 2.09E-07 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 1.72E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | 2.24E-06 | NA | mr1167 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 9.04E-22 | mr1179 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | 3.64E-06 | NA | mr1185 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | 5.46E-06 | 5.45E-06 | mr1193 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | 2.53E-06 | NA | mr1275 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 2.28E-06 | mr1289 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 1.74E-06 | mr1311 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 7.64E-07 | mr1318 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 1.06E-08 | mr1321 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 5.82E-09 | mr1342 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 4.45E-06 | mr1358 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | 1.10E-07 | 4.31E-08 | mr1365 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | 9.56E-06 | NA | mr1400 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 3.00E-09 | mr1403 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 3.33E-06 | mr1412 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 9.78E-06 | mr1425 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 1.00E-06 | mr1432 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 2.33E-08 | mr1446 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 6.30E-07 | mr1502 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 6.41E-06 | mr1521 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 3.06E-10 | mr1524 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | 2.84E-07 | NA | mr1535 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 1.42E-09 | mr1539 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 4.72E-14 | mr1540 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 9.21E-07 | mr1555 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | 1.75E-06 | 5.70E-09 | mr1568 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 1.99E-06 | mr1576 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 9.47E-24 | mr1611 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 1.15E-06 | mr1614 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 2.00E-07 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 1.16E-08 | mr1624 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 5.94E-06 | mr1656 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 3.12E-06 | mr1661 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | 2.50E-06 | 2.51E-06 | mr1674 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 2.32E-14 | mr1720 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 1.10E-12 | mr1732 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 1.71E-09 | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 1.88E-09 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 3.87E-07 | mr1756 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 1.25E-09 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | 1.38E-06 | NA | mr1768 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 2.31E-07 | mr1768 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 7.66E-10 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 2.49E-08 | mr1836 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 8.01E-07 | mr1858 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 8.04E-07 | mr1859 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 5.17E-06 | mr1872 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 5.43E-07 | mr1875 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 2.77E-06 | mr1876 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 4.62E-06 | mr1910 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 5.83E-23 | mr1920 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 1.91E-06 | mr1941 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | 9.20E-06 | NA | mr1950 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | NA | 4.97E-06 | mr1965 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420839554 | 3.79E-06 | NA | mr1969 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |