\
| Variant ID: vg0420837856 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 20837856 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.90, G: 0.10, others allele: 0.00, population size: 76. )
TTTTGAGATCATATCGGGAAGAAGGAACTCAAGTCATGAAAATTTCAGGGATGGTGATTATTCATTCTTTTTTCCCATGCAAGCTGCACGCAAGCTTCTC[A/G]
ATGGAGACGTTGGAAGTCTTGTGGATGCTAGTTTGGAAGGCGGTGTGAACCTCGTTGAGGTTGAAAGAGCTTGCAAAATTGCATGCTGGTGTATTCAAGA
TCTTGAATACACCAGCATGCAATTTTGCAAGCTCTTTCAACCTCAACGAGGTTCACACCGCCTTCCAAACTAGCATCCACAAGACTTCCAACGTCTCCAT[T/C]
GAGAAGCTTGCGTGCAGCTTGCATGGGAAAAAAGAATGAATAATCACCATCCCTGAAATTTTCATGACTTGAGTTCCTTCTTCCCGATATGATCTCAAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.30% | 30.70% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 35.90% | 64.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 23.80% | 76.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 92.00% | 8.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 89.20% | 10.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 18.00% | 82.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 64.10% | 35.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 34.00% | 66.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 45.80% | 54.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 42.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0420837856 | A -> G | LOC_Os04g34410.1 | missense_variant ; p.Asn746Asp; MODERATE | nonsynonymous_codon | Average:12.213; most accessible tissue: Callus, score: 17.37 | benign |
-0.102 |
TOLERATED | 0.45 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0420837856 | NA | 3.37E-06 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420837856 | NA | 3.99E-13 | mr1031 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420837856 | NA | 2.75E-10 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420837856 | NA | 3.65E-07 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420837856 | NA | 2.08E-13 | mr1056 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420837856 | NA | 1.85E-06 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420837856 | NA | 6.10E-07 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420837856 | NA | 1.53E-19 | mr1179 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420837856 | NA | 8.89E-06 | mr1311 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420837856 | NA | 1.77E-08 | mr1321 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420837856 | NA | 1.67E-08 | mr1342 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420837856 | 8.14E-07 | 1.16E-07 | mr1365 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420837856 | NA | 7.29E-06 | mr1387 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420837856 | NA | 2.29E-08 | mr1403 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420837856 | NA | 3.28E-06 | mr1432 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420837856 | NA | 4.38E-06 | mr1502 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420837856 | NA | 3.30E-12 | mr1540 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420837856 | NA | 9.30E-07 | mr1555 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420837856 | NA | 4.05E-08 | mr1568 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420837856 | NA | 4.98E-06 | mr1614 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420837856 | NA | 4.34E-07 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420837856 | NA | 3.96E-06 | mr1661 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420837856 | 3.14E-06 | 3.15E-06 | mr1674 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420837856 | NA | 7.52E-14 | mr1720 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420837856 | NA | 3.40E-10 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420837856 | NA | 2.59E-06 | mr1761 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420837856 | NA | 1.75E-08 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420837856 | 3.15E-08 | 3.13E-18 | mr1768 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420837856 | NA | 4.34E-07 | mr1768 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420837856 | NA | 1.76E-08 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420837856 | NA | 9.05E-08 | mr1836 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420837856 | NA | 3.37E-06 | mr1858 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420837856 | NA | 3.38E-06 | mr1859 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420837856 | NA | 9.10E-06 | mr1872 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420837856 | NA | 2.68E-06 | mr1875 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420837856 | NA | 2.39E-11 | mr1938 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |