RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0420837856:

Variant ID: vg0420837856 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 20837856
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.90, G: 0.10, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTGAGATCATATCGGGAAGAAGGAACTCAAGTCATGAAAATTTCAGGGATGGTGATTATTCATTCTTTTTTCCCATGCAAGCTGCACGCAAGCTTCTC[A/G]
ATGGAGACGTTGGAAGTCTTGTGGATGCTAGTTTGGAAGGCGGTGTGAACCTCGTTGAGGTTGAAAGAGCTTGCAAAATTGCATGCTGGTGTATTCAAGA

Reverse complement sequence

TCTTGAATACACCAGCATGCAATTTTGCAAGCTCTTTCAACCTCAACGAGGTTCACACCGCCTTCCAAACTAGCATCCACAAGACTTCCAACGTCTCCAT[T/C]
GAGAAGCTTGCGTGCAGCTTGCATGGGAAAAAAGAATGAATAATCACCATCCCTGAAATTTTCATGACTTGAGTTCCTTCTTCCCGATATGATCTCAAAA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.30%	30.70%	0.00%	0.00%	NA
All Indica	2759	93.30%	6.70%	0.00%	0.00%	NA
All Japonica	1512	35.90%	64.10%	0.00%	0.00%	NA
Aus	269	23.80%	76.20%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	94.80%	5.20%	0.00%	0.00%	NA
Indica III	913	92.00%	8.00%	0.00%	0.00%	NA
Indica Intermediate	786	89.20%	10.80%	0.00%	0.00%	NA
Temperate Japonica	767	18.00%	82.00%	0.00%	0.00%	NA
Tropical Japonica	504	64.10%	35.90%	0.00%	0.00%	NA
Japonica Intermediate	241	34.00%	66.00%	0.00%	0.00%	NA
VI/Aromatic	96	45.80%	54.20%	0.00%	0.00%	NA
Intermediate	90	57.80%	42.20%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0420837856	A -> G	LOC_Os04g34410.1	missense_variant ; p.Asn746Asp; MODERATE	nonsynonymous_codon	Average:12.213; most accessible tissue: Callus, score: 17.37	benign	-0.102	TOLERATED	0.45

Showing 1 to 1 of 1 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0420837856	NA	3.37E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420837856	NA	3.99E-13	mr1031	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420837856	NA	2.75E-10	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420837856	NA	3.65E-07	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420837856	NA	2.08E-13	mr1056	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420837856	NA	1.85E-06	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420837856	NA	6.10E-07	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420837856	NA	1.53E-19	mr1179	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420837856	NA	8.89E-06	mr1311	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420837856	NA	1.77E-08	mr1321	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 36 entries

Previous1 2 3 4Next

Search for Variation information by Variation ID:

Detailed information for vg0420837856:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact