Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0420836689:

Variant ID: vg0420836689 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 20836689
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:

CCGCGACGACGGCTACAGGCGTGCGTGGAGCCGGCTGTTGAGGAGGCTGGTGCAGGAGAGCATGAGCTTCTGTAGCCTCAGCATCAGCAGGCACGGTAAT[G/A]
TTAATTTTCGTGGATGACTTCACCAGAATCAAGAATCTGATTCTGAATCTGAATCAAGAATTTAATTTGGAGATGGACAGTATGCTCTATTGCTATACCA

Reverse complement sequence

TGGTATAGCAATAGAGCATACTGTCCATCTCCAAATTAAATTCTTGATTCAGATTCAGAATCAGATTCTTGATTCTGGTGAAGTCATCCACGAAAATTAA[C/T]
ATTACCGTGCCTGCTGATGCTGAGGCTACAGAAGCTCATGCTCTCCTGCACCAGCCTCCTCAACAGCCGGCTCCACGCACGCCTGTAGCCGTCGTCGCGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.30%	3.10%	4.08%	21.48%	NA
All Indica	2759	77.20%	4.30%	3.48%	15.01%	NA
All Japonica	1512	65.70%	0.40%	1.92%	32.01%	NA
Aus	269	43.90%	0.70%	20.45%	34.94%	NA
Indica I	595	55.50%	9.70%	7.23%	27.56%	NA
Indica II	465	75.90%	2.40%	1.94%	19.78%	NA
Indica III	913	94.30%	1.00%	1.10%	3.61%	NA
Indica Intermediate	786	74.40%	5.30%	4.33%	15.90%	NA
Temperate Japonica	767	83.60%	0.10%	0.78%	15.51%	NA
Tropical Japonica	504	37.50%	0.80%	4.56%	57.14%	NA
Japonica Intermediate	241	67.60%	0.40%	0.00%	31.95%	NA
VI/Aromatic	96	59.40%	20.80%	6.25%	13.54%	NA
Intermediate	90	81.10%	0.00%	7.78%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0420836689	G -> DEL	N	N	silent_mutation	Average:35.767; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0420836689	G -> A	LOC_Os04g34410.1	intron_variant ; MODIFIER	silent_mutation	Average:35.767; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0420836689	NA	7.39E-06	mr1037	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689	NA	5.79E-06	mr1049	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689	3.62E-06	2.14E-09	mr1064	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689	5.20E-06	8.37E-09	mr1125	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689	3.68E-06	3.53E-09	mr1136	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689	NA	5.73E-07	mr1176	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689	NA	6.23E-07	mr1193	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689	NA	2.48E-06	mr1316	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689	NA	2.88E-06	mr1448	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689	NA	6.33E-08	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689	NA	8.91E-08	mr1534	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689	NA	2.95E-06	mr1671	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689	4.84E-06	2.02E-08	mr1679	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689	NA	9.93E-06	mr1693	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689	NA	5.81E-06	mr1716	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689	9.06E-06	6.79E-08	mr1741	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689	NA	5.17E-07	mr1798	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689	NA	3.28E-06	mr1879	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689	NA	7.79E-07	mr1981	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689	NA	1.57E-07	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689	NA	8.70E-06	mr1561_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251