\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420836689:

Variant ID: vg0420836689 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 20836689
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:


CCGCGACGACGGCTACAGGCGTGCGTGGAGCCGGCTGTTGAGGAGGCTGGTGCAGGAGAGCATGAGCTTCTGTAGCCTCAGCATCAGCAGGCACGGTAAT[G/A]
TTAATTTTCGTGGATGACTTCACCAGAATCAAGAATCTGATTCTGAATCTGAATCAAGAATTTAATTTGGAGATGGACAGTATGCTCTATTGCTATACCA

Reverse complement sequence

TGGTATAGCAATAGAGCATACTGTCCATCTCCAAATTAAATTCTTGATTCAGATTCAGAATCAGATTCTTGATTCTGGTGAAGTCATCCACGAAAATTAA[C/T]
ATTACCGTGCCTGCTGATGCTGAGGCTACAGAAGCTCATGCTCTCCTGCACCAGCCTCCTCAACAGCCGGCTCCACGCACGCCTGTAGCCGTCGTCGCGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.30% 3.10% 4.08% 21.48% NA
All Indica  2759 77.20% 4.30% 3.48% 15.01% NA
All Japonica  1512 65.70% 0.40% 1.92% 32.01% NA
Aus  269 43.90% 0.70% 20.45% 34.94% NA
Indica I  595 55.50% 9.70% 7.23% 27.56% NA
Indica II  465 75.90% 2.40% 1.94% 19.78% NA
Indica III  913 94.30% 1.00% 1.10% 3.61% NA
Indica Intermediate  786 74.40% 5.30% 4.33% 15.90% NA
Temperate Japonica  767 83.60% 0.10% 0.78% 15.51% NA
Tropical Japonica  504 37.50% 0.80% 4.56% 57.14% NA
Japonica Intermediate  241 67.60% 0.40% 0.00% 31.95% NA
VI/Aromatic  96 59.40% 20.80% 6.25% 13.54% NA
Intermediate  90 81.10% 0.00% 7.78% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0420836689 G -> DEL N N silent_mutation Average:35.767; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0420836689 G -> A LOC_Os04g34410.1 intron_variant ; MODIFIER silent_mutation Average:35.767; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0420836689 NA 7.39E-06 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689 NA 5.79E-06 mr1049 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689 3.62E-06 2.14E-09 mr1064 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689 5.20E-06 8.37E-09 mr1125 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689 3.68E-06 3.53E-09 mr1136 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689 NA 5.73E-07 mr1176 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689 NA 6.23E-07 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689 NA 2.48E-06 mr1316 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689 NA 2.88E-06 mr1448 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689 NA 6.33E-08 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689 NA 8.91E-08 mr1534 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689 NA 2.95E-06 mr1671 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689 4.84E-06 2.02E-08 mr1679 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689 NA 9.93E-06 mr1693 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689 NA 5.81E-06 mr1716 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689 9.06E-06 6.79E-08 mr1741 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689 NA 5.17E-07 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689 NA 3.28E-06 mr1879 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689 NA 7.79E-07 mr1981 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689 NA 1.57E-07 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420836689 NA 8.70E-06 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251