\
| Variant ID: vg0420829235 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 20829235 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 68. )
TAGTTGGAAAGGCAAGCTACTTTCGGTTGGAGGTCGTCTCGTGCTCATCAACTCAGTGTTGAGCAGCCTTGCAATGTATATGTTATCCTTCTTTGAAGTG[C/A]
CTAAAGGCATAATCAAAAAGCTGGACTATTATAGATCCAGATTTTTTTGGCAAAGTGATGAACACAAGAAGAAGTACAGATTGGCTAGATGGAGTGTTCT
AGAACACTCCATCTAGCCAATCTGTACTTCTTCTTGTGTTCATCACTTTGCCAAAAAAATCTGGATCTATAATAGTCCAGCTTTTTGATTATGCCTTTAG[G/T]
CACTTCAAAGAAGGATAACATATACATTGCAAGGCTGCTCAACACTGAGTTGATGAGCACGAGACGACCTCCAACCGAAAGTAGCTTGCCTTTCCAACTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 26.50% | 4.50% | 4.87% | 64.07% | NA |
| All Indica | 2759 | 7.20% | 0.50% | 2.10% | 90.21% | NA |
| All Japonica | 1512 | 53.30% | 9.90% | 6.15% | 30.62% | NA |
| Aus | 269 | 76.60% | 0.00% | 18.59% | 4.83% | NA |
| Indica I | 595 | 0.80% | 0.00% | 3.19% | 95.97% | NA |
| Indica II | 465 | 5.60% | 0.90% | 1.94% | 91.61% | NA |
| Indica III | 913 | 8.90% | 0.10% | 0.99% | 90.03% | NA |
| Indica Intermediate | 786 | 10.90% | 1.10% | 2.67% | 85.24% | NA |
| Temperate Japonica | 767 | 81.90% | 0.10% | 2.22% | 15.78% | NA |
| Tropical Japonica | 504 | 12.50% | 22.40% | 12.30% | 52.78% | NA |
| Japonica Intermediate | 241 | 47.70% | 14.90% | 5.81% | 31.54% | NA |
| VI/Aromatic | 96 | 14.60% | 40.60% | 10.42% | 34.38% | NA |
| Intermediate | 90 | 33.30% | 12.20% | 21.11% | 33.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0420829235 | C -> DEL | LOC_Os04g34400.1 | N | frameshift_variant | Average:11.616; most accessible tissue: Callus, score: 73.077 | N | N | N | N |
| vg0420829235 | C -> A | LOC_Os04g34400.1 | missense_variant ; p.Pro261Thr; MODERATE | nonsynonymous_codon ; P261T | Average:11.616; most accessible tissue: Callus, score: 73.077 | possibly damaging |
1.875 |
DELETERIOUS | 0.03 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0420829235 | NA | 1.28E-06 | mr1119 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420829235 | NA | 6.13E-06 | mr1240 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420829235 | NA | 6.92E-08 | mr1584 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420829235 | NA | 1.01E-08 | mr1695 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420829235 | NA | 4.04E-06 | mr1866 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420829235 | NA | 5.49E-07 | mr1961 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420829235 | NA | 5.87E-06 | mr1695_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |