\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420829235:

Variant ID: vg0420829235 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 20829235
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:


TAGTTGGAAAGGCAAGCTACTTTCGGTTGGAGGTCGTCTCGTGCTCATCAACTCAGTGTTGAGCAGCCTTGCAATGTATATGTTATCCTTCTTTGAAGTG[C/A]
CTAAAGGCATAATCAAAAAGCTGGACTATTATAGATCCAGATTTTTTTGGCAAAGTGATGAACACAAGAAGAAGTACAGATTGGCTAGATGGAGTGTTCT

Reverse complement sequence

AGAACACTCCATCTAGCCAATCTGTACTTCTTCTTGTGTTCATCACTTTGCCAAAAAAATCTGGATCTATAATAGTCCAGCTTTTTGATTATGCCTTTAG[G/T]
CACTTCAAAGAAGGATAACATATACATTGCAAGGCTGCTCAACACTGAGTTGATGAGCACGAGACGACCTCCAACCGAAAGTAGCTTGCCTTTCCAACTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 26.50% 4.50% 4.87% 64.07% NA
All Indica  2759 7.20% 0.50% 2.10% 90.21% NA
All Japonica  1512 53.30% 9.90% 6.15% 30.62% NA
Aus  269 76.60% 0.00% 18.59% 4.83% NA
Indica I  595 0.80% 0.00% 3.19% 95.97% NA
Indica II  465 5.60% 0.90% 1.94% 91.61% NA
Indica III  913 8.90% 0.10% 0.99% 90.03% NA
Indica Intermediate  786 10.90% 1.10% 2.67% 85.24% NA
Temperate Japonica  767 81.90% 0.10% 2.22% 15.78% NA
Tropical Japonica  504 12.50% 22.40% 12.30% 52.78% NA
Japonica Intermediate  241 47.70% 14.90% 5.81% 31.54% NA
VI/Aromatic  96 14.60% 40.60% 10.42% 34.38% NA
Intermediate  90 33.30% 12.20% 21.11% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0420829235 C -> DEL LOC_Os04g34400.1 N frameshift_variant Average:11.616; most accessible tissue: Callus, score: 73.077 N N N N
vg0420829235 C -> A LOC_Os04g34400.1 missense_variant ; p.Pro261Thr; MODERATE nonsynonymous_codon ; P261T Average:11.616; most accessible tissue: Callus, score: 73.077 possibly damaging 1.875 DELETERIOUS 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0420829235 NA 1.28E-06 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420829235 NA 6.13E-06 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420829235 NA 6.92E-08 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420829235 NA 1.01E-08 mr1695 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420829235 NA 4.04E-06 mr1866 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420829235 NA 5.49E-07 mr1961 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420829235 NA 5.87E-06 mr1695_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251