\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420828431:

Variant ID: vg0420828431 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 20828431
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


ACCAATCTGTCTGTTGAATGTAAGTTTCAAAATATTCACAAAAGTCTTGGCAAATAGGATTGCGTTGGTAGCCCAAAAAATCATAAAGCCTTCTCAGACA[G/A]
CTTTTTTAAAGGGTAGGAACATTATGGAAGGAGCTATAATTTTACATGAGACCTTACATGAGATGCATAAAAGAAAGAAGGATGGTGTTATTCTTAAGCT

Reverse complement sequence

AGCTTAAGAATAACACCATCCTTCTTTCTTTTATGCATCTCATGTAAGGTCTCATGTAAAATTATAGCTCCTTCCATAATGTTCCTACCCTTTAAAAAAG[C/T]
TGTCTGAGAAGGCTTTATGATTTTTTGGGCTACCAACGCAATCCTATTTGCCAAGACTTTTGTGAATATTTTGAAACTTACATTCAACAGACAGATTGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.70% 6.20% 15.49% 46.70% NA
All Indica  2759 7.60% 10.50% 24.07% 57.85% NA
All Japonica  1512 64.90% 0.10% 1.79% 33.20% NA
Aus  269 77.00% 0.00% 0.74% 22.30% NA
Indica I  595 1.00% 7.60% 19.50% 71.93% NA
Indica II  465 5.40% 22.20% 21.94% 50.54% NA
Indica III  913 9.10% 11.30% 29.57% 50.05% NA
Indica Intermediate  786 12.20% 4.80% 22.39% 60.56% NA
Temperate Japonica  767 82.50% 0.00% 0.26% 17.21% NA
Tropical Japonica  504 37.10% 0.20% 4.76% 57.94% NA
Japonica Intermediate  241 67.20% 0.00% 0.41% 32.37% NA
VI/Aromatic  96 55.20% 0.00% 31.25% 13.54% NA
Intermediate  90 48.90% 1.10% 10.00% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0420828431 G -> DEL N N silent_mutation Average:20.356; most accessible tissue: Zhenshan97 root, score: 34.536 N N N N
vg0420828431 G -> A LOC_Os04g34400.1 upstream_gene_variant ; 24.0bp to feature; MODIFIER silent_mutation Average:20.356; most accessible tissue: Zhenshan97 root, score: 34.536 N N N N
vg0420828431 G -> A LOC_Os04g34380.1 downstream_gene_variant ; 4838.0bp to feature; MODIFIER silent_mutation Average:20.356; most accessible tissue: Zhenshan97 root, score: 34.536 N N N N
vg0420828431 G -> A LOC_Os04g34390.1 downstream_gene_variant ; 720.0bp to feature; MODIFIER silent_mutation Average:20.356; most accessible tissue: Zhenshan97 root, score: 34.536 N N N N
vg0420828431 G -> A LOC_Os04g34390-LOC_Os04g34400 intergenic_region ; MODIFIER silent_mutation Average:20.356; most accessible tissue: Zhenshan97 root, score: 34.536 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0420828431 NA 1.08E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431 NA 2.47E-13 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431 NA 2.16E-11 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431 NA 1.41E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431 NA 7.67E-14 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431 NA 1.35E-16 mr1147 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431 NA 2.04E-19 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431 7.41E-06 7.40E-06 mr1193 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431 NA 1.40E-08 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431 NA 1.24E-09 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431 1.99E-06 4.53E-07 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431 NA 9.53E-09 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431 NA 2.52E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431 3.70E-06 6.18E-06 mr1500 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431 NA 6.78E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431 NA 1.19E-10 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431 NA 8.41E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431 NA 6.72E-13 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431 NA 9.86E-06 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431 NA 1.71E-07 mr1568 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431 NA 4.81E-06 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431 NA 3.27E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431 9.27E-06 NA mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431 8.92E-07 1.35E-15 mr1720 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431 NA 8.72E-09 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431 NA 1.08E-06 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431 NA 2.30E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431 NA 1.23E-08 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431 4.83E-06 NA mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431 NA 6.57E-07 mr1768 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431 NA 1.64E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431 NA 4.45E-09 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431 NA 1.90E-06 mr1858 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431 NA 1.91E-06 mr1859 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431 NA 2.02E-06 mr1872 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431 NA 9.79E-07 mr1875 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431 NA 9.93E-08 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431 NA 3.38E-15 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251