Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420828431:

Variant ID: vg0420828431 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 20828431
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

ACCAATCTGTCTGTTGAATGTAAGTTTCAAAATATTCACAAAAGTCTTGGCAAATAGGATTGCGTTGGTAGCCCAAAAAATCATAAAGCCTTCTCAGACA[G/A]
CTTTTTTAAAGGGTAGGAACATTATGGAAGGAGCTATAATTTTACATGAGACCTTACATGAGATGCATAAAAGAAAGAAGGATGGTGTTATTCTTAAGCT

Reverse complement sequence

AGCTTAAGAATAACACCATCCTTCTTTCTTTTATGCATCTCATGTAAGGTCTCATGTAAAATTATAGCTCCTTCCATAATGTTCCTACCCTTTAAAAAAG[C/T]
TGTCTGAGAAGGCTTTATGATTTTTTGGGCTACCAACGCAATCCTATTTGCCAAGACTTTTGTGAATATTTTGAAACTTACATTCAACAGACAGATTGGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.70%	6.20%	15.49%	46.70%	NA
All Indica	2759	7.60%	10.50%	24.07%	57.85%	NA
All Japonica	1512	64.90%	0.10%	1.79%	33.20%	NA
Aus	269	77.00%	0.00%	0.74%	22.30%	NA
Indica I	595	1.00%	7.60%	19.50%	71.93%	NA
Indica II	465	5.40%	22.20%	21.94%	50.54%	NA
Indica III	913	9.10%	11.30%	29.57%	50.05%	NA
Indica Intermediate	786	12.20%	4.80%	22.39%	60.56%	NA
Temperate Japonica	767	82.50%	0.00%	0.26%	17.21%	NA
Tropical Japonica	504	37.10%	0.20%	4.76%	57.94%	NA
Japonica Intermediate	241	67.20%	0.00%	0.41%	32.37%	NA
VI/Aromatic	96	55.20%	0.00%	31.25%	13.54%	NA
Intermediate	90	48.90%	1.10%	10.00%	40.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0420828431	G -> DEL	N	N	silent_mutation	Average:20.356; most accessible tissue: Zhenshan97 root, score: 34.536	N	N	N	N
vg0420828431	G -> A	LOC_Os04g34400.1	upstream_gene_variant ; 24.0bp to feature; MODIFIER	silent_mutation	Average:20.356; most accessible tissue: Zhenshan97 root, score: 34.536	N	N	N	N
vg0420828431	G -> A	LOC_Os04g34380.1	downstream_gene_variant ; 4838.0bp to feature; MODIFIER	silent_mutation	Average:20.356; most accessible tissue: Zhenshan97 root, score: 34.536	N	N	N	N
vg0420828431	G -> A	LOC_Os04g34390.1	downstream_gene_variant ; 720.0bp to feature; MODIFIER	silent_mutation	Average:20.356; most accessible tissue: Zhenshan97 root, score: 34.536	N	N	N	N
vg0420828431	G -> A	LOC_Os04g34390-LOC_Os04g34400	intergenic_region ; MODIFIER	silent_mutation	Average:20.356; most accessible tissue: Zhenshan97 root, score: 34.536	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0420828431	NA	1.08E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431	NA	2.47E-13	mr1031	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431	NA	2.16E-11	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431	NA	1.41E-07	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431	NA	7.67E-14	mr1056	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431	NA	1.35E-16	mr1147	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431	NA	2.04E-19	mr1179	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431	7.41E-06	7.40E-06	mr1193	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431	NA	1.40E-08	mr1321	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431	NA	1.24E-09	mr1342	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431	1.99E-06	4.53E-07	mr1365	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431	NA	9.53E-09	mr1403	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431	NA	2.52E-06	mr1432	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431	3.70E-06	6.18E-06	mr1500	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431	NA	6.78E-06	mr1502	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431	NA	1.19E-10	mr1524	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431	NA	8.41E-09	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431	NA	6.72E-13	mr1540	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431	NA	9.86E-06	mr1555	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431	NA	1.71E-07	mr1568	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431	NA	4.81E-06	mr1614	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431	NA	3.27E-06	mr1621	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431	9.27E-06	NA	mr1679	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431	8.92E-07	1.35E-15	mr1720	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431	NA	8.72E-09	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431	NA	1.08E-06	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431	NA	2.30E-06	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431	NA	1.23E-08	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431	4.83E-06	NA	mr1768	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431	NA	6.57E-07	mr1768	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431	NA	1.64E-07	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431	NA	4.45E-09	mr1836	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431	NA	1.90E-06	mr1858	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431	NA	1.91E-06	mr1859	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431	NA	2.02E-06	mr1872	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431	NA	9.79E-07	mr1875	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431	NA	9.93E-08	mr1946	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420828431	NA	3.38E-15	mr1720_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251