\
| Variant ID: vg0420827862 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 20827862 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.54, C: 0.46, others allele: 0.00, population size: 90. )
TTCTTGTGCATAAGATTGTCAGACGTAAATGTAAGCTACATTGTGGATCTATATTGAAATGTTAATTAGTGAAATCAACACAGCAGGTACCATTGCTTAG[C/T]
CTATAGCAATGTTTAAACCTACGACTTCCCTTTCCCATATTCTTTTGAAGCTCATCCCCCTAGGCTTTTCAACCAAGCGGTCTAATTACTACTTTCGATT
AATCGAAAGTAGTAATTAGACCGCTTGGTTGAAAAGCCTAGGGGGATGAGCTTCAAAAGAATATGGGAAAGGGAAGTCGTAGGTTTAAACATTGCTATAG[G/A]
CTAAGCAATGGTACCTGCTGTGTTGATTTCACTAATTAACATTTCAATATAGATCCACAATGTAGCTTACATTTACGTCTGACAATCTTATGCACAAGAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.30% | 30.70% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 93.40% | 6.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 35.80% | 64.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 23.40% | 76.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.10% | 4.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 91.80% | 8.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 89.40% | 10.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 18.00% | 82.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 64.10% | 35.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 33.20% | 66.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 44.80% | 55.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 43.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0420827862 | C -> T | LOC_Os04g34400.1 | upstream_gene_variant ; 593.0bp to feature; MODIFIER | silent_mutation | Average:65.306; most accessible tissue: Minghui63 flag leaf, score: 78.782 | N | N | N | N |
| vg0420827862 | C -> T | LOC_Os04g34380.1 | downstream_gene_variant ; 4269.0bp to feature; MODIFIER | silent_mutation | Average:65.306; most accessible tissue: Minghui63 flag leaf, score: 78.782 | N | N | N | N |
| vg0420827862 | C -> T | LOC_Os04g34390.1 | downstream_gene_variant ; 151.0bp to feature; MODIFIER | silent_mutation | Average:65.306; most accessible tissue: Minghui63 flag leaf, score: 78.782 | N | N | N | N |
| vg0420827862 | C -> T | LOC_Os04g34390-LOC_Os04g34400 | intergenic_region ; MODIFIER | silent_mutation | Average:65.306; most accessible tissue: Minghui63 flag leaf, score: 78.782 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0420827862 | NA | 1.63E-06 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420827862 | NA | 4.43E-13 | mr1031 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420827862 | NA | 5.72E-11 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420827862 | NA | 3.64E-08 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420827862 | NA | 2.14E-13 | mr1056 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420827862 | NA | 2.95E-06 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420827862 | NA | 5.04E-17 | mr1147 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420827862 | NA | 9.61E-20 | mr1179 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420827862 | NA | 2.95E-06 | mr1311 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420827862 | NA | 1.89E-08 | mr1321 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420827862 | 7.07E-06 | NA | mr1339 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420827862 | NA | 4.45E-09 | mr1342 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420827862 | 9.52E-07 | 1.82E-07 | mr1365 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420827862 | NA | 4.77E-08 | mr1403 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420827862 | NA | 1.72E-06 | mr1432 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420827862 | NA | 7.20E-06 | mr1502 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420827862 | NA | 2.34E-10 | mr1524 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420827862 | 3.68E-06 | NA | mr1535 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420827862 | NA | 1.06E-08 | mr1539 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420827862 | NA | 3.48E-13 | mr1540 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420827862 | NA | 1.37E-06 | mr1555 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420827862 | 7.75E-06 | 2.06E-08 | mr1568 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420827862 | NA | 3.66E-06 | mr1614 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420827862 | NA | 1.09E-06 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420827862 | 8.63E-06 | 8.66E-06 | mr1674 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420827862 | NA | 1.83E-13 | mr1720 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420827862 | NA | 8.69E-09 | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420827862 | NA | 4.49E-09 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420827862 | NA | 6.52E-07 | mr1756 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420827862 | NA | 4.32E-09 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420827862 | 2.56E-07 | 3.63E-17 | mr1768 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420827862 | NA | 5.62E-08 | mr1768 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420827862 | NA | 1.78E-08 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420827862 | NA | 1.94E-08 | mr1836 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420827862 | NA | 2.07E-06 | mr1872 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420827862 | NA | 1.14E-06 | mr1875 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420827862 | NA | 2.13E-11 | mr1938 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420827862 | NA | 2.14E-14 | mr1720_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |