\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420812162:

Variant ID: vg0420812162 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 20812162
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATTCAATTGGAATCATTCAACATATTAACTTAGTTAAACTGATTGGGTTTTGTTGTGAAGGTGATAATAGGTTACTTGTGTATGAATACATGCCAAAC[T/C]
GCTCCCTTGATGTGTGTTTATTCGAGGCTAATGATATAGTTTTGGATTGGACTACTAGGTACCAAATTGCCATTGGAGTTGCCAGAGGCCTTGCCTATTT

Reverse complement sequence

AAATAGGCAAGGCCTCTGGCAACTCCAATGGCAATTTGGTACCTAGTAGTCCAATCCAAAACTATATCATTAGCCTCGAATAAACACACATCAAGGGAGC[A/G]
GTTTGGCATGTATTCATACACAAGTAACCTATTATCACCTTCACAACAAAACCCAATCAGTTTAACTAAGTTAATATGTTGAATGATTCCAATTGAATTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.70% 0.10% 1.12% 67.01% NA
All Indica  2759 7.70% 0.20% 1.70% 90.40% NA
All Japonica  1512 64.90% 0.00% 0.40% 34.66% NA
Aus  269 77.00% 0.00% 0.00% 23.05% NA
Indica I  595 1.30% 0.70% 1.34% 96.64% NA
Indica II  465 6.20% 0.40% 1.72% 91.61% NA
Indica III  913 9.30% 0.00% 1.10% 89.59% NA
Indica Intermediate  786 11.50% 0.00% 2.67% 85.88% NA
Temperate Japonica  767 82.40% 0.00% 0.00% 17.60% NA
Tropical Japonica  504 37.30% 0.00% 0.99% 61.71% NA
Japonica Intermediate  241 67.20% 0.00% 0.41% 32.37% NA
VI/Aromatic  96 57.30% 0.00% 0.00% 42.71% NA
Intermediate  90 48.90% 0.00% 0.00% 51.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0420812162 T -> C LOC_Os04g34360.1 missense_variant ; p.Cys349Arg; MODERATE nonsynonymous_codon ; C349R Average:13.278; most accessible tissue: Callus, score: 41.682 benign -0.627 TOLERATED 0.41
vg0420812162 T -> DEL LOC_Os04g34360.1 N frameshift_variant Average:13.278; most accessible tissue: Callus, score: 41.682 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0420812162 NA 7.42E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162 NA 2.02E-10 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162 NA 2.52E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162 NA 1.05E-06 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162 NA 1.95E-19 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162 2.05E-07 2.05E-07 mr1193 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162 NA 6.26E-06 mr1295 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162 NA 8.80E-06 mr1318 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162 NA 1.37E-07 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162 NA 2.83E-06 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162 NA 2.69E-09 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162 NA 4.50E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162 1.88E-06 NA mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162 NA 1.23E-12 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162 NA 1.52E-08 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162 NA 1.39E-07 mr1568 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162 NA 4.00E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162 NA 5.19E-06 mr1709 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162 NA 4.50E-13 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162 NA 1.97E-08 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162 NA 9.02E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162 NA 4.94E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162 NA 1.95E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162 NA 4.62E-07 mr1768 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162 NA 1.38E-08 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162 NA 7.92E-08 mr1858 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162 NA 7.94E-08 mr1859 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251