Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420812162:

Variant ID: vg0420812162 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 20812162
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAATTCAATTGGAATCATTCAACATATTAACTTAGTTAAACTGATTGGGTTTTGTTGTGAAGGTGATAATAGGTTACTTGTGTATGAATACATGCCAAAC[T/C]
GCTCCCTTGATGTGTGTTTATTCGAGGCTAATGATATAGTTTTGGATTGGACTACTAGGTACCAAATTGCCATTGGAGTTGCCAGAGGCCTTGCCTATTT

Reverse complement sequence

AAATAGGCAAGGCCTCTGGCAACTCCAATGGCAATTTGGTACCTAGTAGTCCAATCCAAAACTATATCATTAGCCTCGAATAAACACACATCAAGGGAGC[A/G]
GTTTGGCATGTATTCATACACAAGTAACCTATTATCACCTTCACAACAAAACCCAATCAGTTTAACTAAGTTAATATGTTGAATGATTCCAATTGAATTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.70%	0.10%	1.12%	67.01%	NA
All Indica	2759	7.70%	0.20%	1.70%	90.40%	NA
All Japonica	1512	64.90%	0.00%	0.40%	34.66%	NA
Aus	269	77.00%	0.00%	0.00%	23.05%	NA
Indica I	595	1.30%	0.70%	1.34%	96.64%	NA
Indica II	465	6.20%	0.40%	1.72%	91.61%	NA
Indica III	913	9.30%	0.00%	1.10%	89.59%	NA
Indica Intermediate	786	11.50%	0.00%	2.67%	85.88%	NA
Temperate Japonica	767	82.40%	0.00%	0.00%	17.60%	NA
Tropical Japonica	504	37.30%	0.00%	0.99%	61.71%	NA
Japonica Intermediate	241	67.20%	0.00%	0.41%	32.37%	NA
VI/Aromatic	96	57.30%	0.00%	0.00%	42.71%	NA
Intermediate	90	48.90%	0.00%	0.00%	51.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0420812162	T -> C	LOC_Os04g34360.1	missense_variant ; p.Cys349Arg; MODERATE	nonsynonymous_codon ; C349R	Average:13.278; most accessible tissue: Callus, score: 41.682	benign	-0.627	TOLERATED	0.41
vg0420812162	T -> DEL	LOC_Os04g34360.1	N	frameshift_variant	Average:13.278; most accessible tissue: Callus, score: 41.682	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0420812162	NA	7.42E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162	NA	2.02E-10	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162	NA	2.52E-07	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162	NA	1.05E-06	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162	NA	1.95E-19	mr1179	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162	2.05E-07	2.05E-07	mr1193	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162	NA	6.26E-06	mr1295	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162	NA	8.80E-06	mr1318	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162	NA	1.37E-07	mr1321	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162	NA	2.83E-06	mr1365	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162	NA	2.69E-09	mr1403	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162	NA	4.50E-06	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162	1.88E-06	NA	mr1535	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162	NA	1.23E-12	mr1540	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162	NA	1.52E-08	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162	NA	1.39E-07	mr1568	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162	NA	4.00E-06	mr1621	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162	NA	5.19E-06	mr1709	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162	NA	4.50E-13	mr1720	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162	NA	1.97E-08	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162	NA	9.02E-07	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162	NA	4.94E-08	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162	NA	1.95E-07	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162	NA	4.62E-07	mr1768	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162	NA	1.38E-08	mr1836	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162	NA	7.92E-08	mr1858	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420812162	NA	7.94E-08	mr1859	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251