\
| Variant ID: vg0420807684 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 20807684 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 92. )
TCCGTTTAAGGGGGGTAGGTTTGTCACACCCTGAAGTTTCCCCCCTTTTCTTGCTTTAAAAATTGGTTAAATAAATTGCCCAAAGAAATTATCTTAATTA[A/T]
CCTAGAGCTAAATCCCTAGTTAATAAATGCAATTAATAATCGGAAATAGCGTGGTGGAATTTTTCTTGAGTTCCCCATGCTCCAATGCATTAACAAGATT
AATCTTGTTAATGCATTGGAGCATGGGGAACTCAAGAAAAATTCCACCACGCTATTTCCGATTATTAATTGCATTTATTAACTAGGGATTTAGCTCTAGG[T/A]
TAATTAAGATAATTTCTTTGGGCAATTTATTTAACCAATTTTTAAAGCAAGAAAAGGGGGGAAACTTCAGGGTGTGACAAACCTACCCCCCTTAAACGGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 24.20% | 17.10% | 6.52% | 52.14% | NA |
| All Indica | 2759 | 3.30% | 29.00% | 7.25% | 60.46% | NA |
| All Japonica | 1512 | 64.20% | 0.10% | 0.53% | 35.19% | NA |
| Aus | 269 | 2.20% | 0.70% | 31.60% | 65.43% | NA |
| Indica I | 595 | 0.30% | 41.20% | 3.53% | 54.96% | NA |
| Indica II | 465 | 3.40% | 38.70% | 6.02% | 51.83% | NA |
| Indica III | 913 | 4.70% | 16.50% | 8.32% | 70.43% | NA |
| Indica Intermediate | 786 | 3.90% | 28.40% | 9.54% | 58.14% | NA |
| Temperate Japonica | 767 | 82.00% | 0.00% | 0.26% | 17.73% | NA |
| Tropical Japonica | 504 | 35.90% | 0.20% | 0.99% | 62.90% | NA |
| Japonica Intermediate | 241 | 66.40% | 0.40% | 0.41% | 32.78% | NA |
| VI/Aromatic | 96 | 42.70% | 0.00% | 8.33% | 48.96% | NA |
| Intermediate | 90 | 38.90% | 7.80% | 7.78% | 45.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0420807684 | A -> DEL | N | N | silent_mutation | Average:11.461; most accessible tissue: Zhenshan97 flag leaf, score: 18.298 | N | N | N | N |
| vg0420807684 | A -> T | LOC_Os04g34360.1 | upstream_gene_variant ; 3434.0bp to feature; MODIFIER | silent_mutation | Average:11.461; most accessible tissue: Zhenshan97 flag leaf, score: 18.298 | N | N | N | N |
| vg0420807684 | A -> T | LOC_Os04g34350.1 | downstream_gene_variant ; 92.0bp to feature; MODIFIER | silent_mutation | Average:11.461; most accessible tissue: Zhenshan97 flag leaf, score: 18.298 | N | N | N | N |
| vg0420807684 | A -> T | LOC_Os04g34350-LOC_Os04g34360 | intergenic_region ; MODIFIER | silent_mutation | Average:11.461; most accessible tissue: Zhenshan97 flag leaf, score: 18.298 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0420807684 | 4.81E-07 | 4.81E-07 | mr1073 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420807684 | NA | 3.10E-06 | mr1365 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420807684 | 6.81E-07 | NA | mr1523 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420807684 | NA | 1.14E-10 | mr1720 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420807684 | NA | 9.88E-07 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |