\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420807684:

Variant ID: vg0420807684 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 20807684
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


TCCGTTTAAGGGGGGTAGGTTTGTCACACCCTGAAGTTTCCCCCCTTTTCTTGCTTTAAAAATTGGTTAAATAAATTGCCCAAAGAAATTATCTTAATTA[A/T]
CCTAGAGCTAAATCCCTAGTTAATAAATGCAATTAATAATCGGAAATAGCGTGGTGGAATTTTTCTTGAGTTCCCCATGCTCCAATGCATTAACAAGATT

Reverse complement sequence

AATCTTGTTAATGCATTGGAGCATGGGGAACTCAAGAAAAATTCCACCACGCTATTTCCGATTATTAATTGCATTTATTAACTAGGGATTTAGCTCTAGG[T/A]
TAATTAAGATAATTTCTTTGGGCAATTTATTTAACCAATTTTTAAAGCAAGAAAAGGGGGGAAACTTCAGGGTGTGACAAACCTACCCCCCTTAAACGGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 24.20% 17.10% 6.52% 52.14% NA
All Indica  2759 3.30% 29.00% 7.25% 60.46% NA
All Japonica  1512 64.20% 0.10% 0.53% 35.19% NA
Aus  269 2.20% 0.70% 31.60% 65.43% NA
Indica I  595 0.30% 41.20% 3.53% 54.96% NA
Indica II  465 3.40% 38.70% 6.02% 51.83% NA
Indica III  913 4.70% 16.50% 8.32% 70.43% NA
Indica Intermediate  786 3.90% 28.40% 9.54% 58.14% NA
Temperate Japonica  767 82.00% 0.00% 0.26% 17.73% NA
Tropical Japonica  504 35.90% 0.20% 0.99% 62.90% NA
Japonica Intermediate  241 66.40% 0.40% 0.41% 32.78% NA
VI/Aromatic  96 42.70% 0.00% 8.33% 48.96% NA
Intermediate  90 38.90% 7.80% 7.78% 45.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0420807684 A -> DEL N N silent_mutation Average:11.461; most accessible tissue: Zhenshan97 flag leaf, score: 18.298 N N N N
vg0420807684 A -> T LOC_Os04g34360.1 upstream_gene_variant ; 3434.0bp to feature; MODIFIER silent_mutation Average:11.461; most accessible tissue: Zhenshan97 flag leaf, score: 18.298 N N N N
vg0420807684 A -> T LOC_Os04g34350.1 downstream_gene_variant ; 92.0bp to feature; MODIFIER silent_mutation Average:11.461; most accessible tissue: Zhenshan97 flag leaf, score: 18.298 N N N N
vg0420807684 A -> T LOC_Os04g34350-LOC_Os04g34360 intergenic_region ; MODIFIER silent_mutation Average:11.461; most accessible tissue: Zhenshan97 flag leaf, score: 18.298 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0420807684 4.81E-07 4.81E-07 mr1073 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420807684 NA 3.10E-06 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420807684 6.81E-07 NA mr1523 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420807684 NA 1.14E-10 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420807684 NA 9.88E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251