Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420802745:

Variant ID: vg0420802745 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 20802745
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTTATTTGAGTCTTCTTTTGCTTTGTTTAATTTGGATTTGAGCATTAATTAGTTCCTATCCCTTGTCTACTTTAGATGTCAGTCCTATCCCTCGTTTGC[G/A]
AGCGCCGCCCCGAGCTTCAGAGTCGCCGCCCTTAGCTTTATCGCCTTCTTAGTCTGTTTGCTTGCTAGTTTTCGTGTTTAGGTTTGTTGCTTGTGGGTTA

Reverse complement sequence

TAACCCACAAGCAACAAACCTAAACACGAAAACTAGCAAGCAAACAGACTAAGAAGGCGATAAAGCTAAGGGCGGCGACTCTGAAGCTCGGGGCGGCGCT[C/T]
GCAAACGAGGGATAGGACTGACATCTAAAGTAGACAAGGGATAGGAACTAATTAATGCTCAAATCCAAATTAAACAAAGCAAAAGAAGACTCAAATAAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	23.80%	0.20%	18.79%	57.26%	NA
All Indica	2759	2.50%	0.30%	15.91%	81.30%	NA
All Japonica	1512	64.20%	0.00%	14.09%	21.69%	NA
Aus	269	1.50%	0.00%	67.66%	30.86%	NA
Indica I	595	1.20%	0.30%	3.70%	94.79%	NA
Indica II	465	4.50%	0.60%	18.49%	76.34%	NA
Indica III	913	1.40%	0.20%	22.45%	75.90%	NA
Indica Intermediate	786	3.40%	0.30%	16.03%	80.28%	NA
Temperate Japonica	767	82.40%	0.00%	2.09%	15.51%	NA
Tropical Japonica	504	35.70%	0.00%	35.32%	28.97%	NA
Japonica Intermediate	241	66.00%	0.00%	7.88%	26.14%	NA
VI/Aromatic	96	44.80%	0.00%	37.50%	17.71%	NA
Intermediate	90	41.10%	0.00%	20.00%	38.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0420802745	G -> DEL	N	N	silent_mutation	Average:7.486; most accessible tissue: Callus, score: 12.278	N	N	N	N
vg0420802745	G -> A	LOC_Os04g34340.1	upstream_gene_variant ; 3675.0bp to feature; MODIFIER	silent_mutation	Average:7.486; most accessible tissue: Callus, score: 12.278	N	N	N	N
vg0420802745	G -> A	LOC_Os04g34350.1	upstream_gene_variant ; 275.0bp to feature; MODIFIER	silent_mutation	Average:7.486; most accessible tissue: Callus, score: 12.278	N	N	N	N
vg0420802745	G -> A	LOC_Os04g34340-LOC_Os04g34350	intergenic_region ; MODIFIER	silent_mutation	Average:7.486; most accessible tissue: Callus, score: 12.278	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0420802745	NA	2.85E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802745	2.92E-06	2.92E-06	mr1193	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802745	NA	9.69E-06	mr1205	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802745	NA	1.07E-09	mr1248	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802745	NA	5.14E-06	mr1344	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802745	NA	5.18E-06	mr1425	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802745	NA	1.56E-08	mr1691	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802745	NA	5.92E-06	mr1704	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802745	NA	2.08E-06	mr1709	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802745	NA	3.96E-06	mr1741	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802745	NA	1.86E-07	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802745	NA	4.18E-07	mr1858	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802745	NA	4.19E-07	mr1859	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802745	NA	6.30E-06	mr1889	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802745	NA	4.77E-08	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802745	3.61E-06	3.61E-06	mr1965	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802745	6.58E-06	NA	mr1486_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251