\
| Variant ID: vg0420802745 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 20802745 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATTTATTTGAGTCTTCTTTTGCTTTGTTTAATTTGGATTTGAGCATTAATTAGTTCCTATCCCTTGTCTACTTTAGATGTCAGTCCTATCCCTCGTTTGC[G/A]
AGCGCCGCCCCGAGCTTCAGAGTCGCCGCCCTTAGCTTTATCGCCTTCTTAGTCTGTTTGCTTGCTAGTTTTCGTGTTTAGGTTTGTTGCTTGTGGGTTA
TAACCCACAAGCAACAAACCTAAACACGAAAACTAGCAAGCAAACAGACTAAGAAGGCGATAAAGCTAAGGGCGGCGACTCTGAAGCTCGGGGCGGCGCT[C/T]
GCAAACGAGGGATAGGACTGACATCTAAAGTAGACAAGGGATAGGAACTAATTAATGCTCAAATCCAAATTAAACAAAGCAAAAGAAGACTCAAATAAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 23.80% | 0.20% | 18.79% | 57.26% | NA |
| All Indica | 2759 | 2.50% | 0.30% | 15.91% | 81.30% | NA |
| All Japonica | 1512 | 64.20% | 0.00% | 14.09% | 21.69% | NA |
| Aus | 269 | 1.50% | 0.00% | 67.66% | 30.86% | NA |
| Indica I | 595 | 1.20% | 0.30% | 3.70% | 94.79% | NA |
| Indica II | 465 | 4.50% | 0.60% | 18.49% | 76.34% | NA |
| Indica III | 913 | 1.40% | 0.20% | 22.45% | 75.90% | NA |
| Indica Intermediate | 786 | 3.40% | 0.30% | 16.03% | 80.28% | NA |
| Temperate Japonica | 767 | 82.40% | 0.00% | 2.09% | 15.51% | NA |
| Tropical Japonica | 504 | 35.70% | 0.00% | 35.32% | 28.97% | NA |
| Japonica Intermediate | 241 | 66.00% | 0.00% | 7.88% | 26.14% | NA |
| VI/Aromatic | 96 | 44.80% | 0.00% | 37.50% | 17.71% | NA |
| Intermediate | 90 | 41.10% | 0.00% | 20.00% | 38.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0420802745 | G -> DEL | N | N | silent_mutation | Average:7.486; most accessible tissue: Callus, score: 12.278 | N | N | N | N |
| vg0420802745 | G -> A | LOC_Os04g34340.1 | upstream_gene_variant ; 3675.0bp to feature; MODIFIER | silent_mutation | Average:7.486; most accessible tissue: Callus, score: 12.278 | N | N | N | N |
| vg0420802745 | G -> A | LOC_Os04g34350.1 | upstream_gene_variant ; 275.0bp to feature; MODIFIER | silent_mutation | Average:7.486; most accessible tissue: Callus, score: 12.278 | N | N | N | N |
| vg0420802745 | G -> A | LOC_Os04g34340-LOC_Os04g34350 | intergenic_region ; MODIFIER | silent_mutation | Average:7.486; most accessible tissue: Callus, score: 12.278 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0420802745 | NA | 2.85E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420802745 | 2.92E-06 | 2.92E-06 | mr1193 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420802745 | NA | 9.69E-06 | mr1205 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420802745 | NA | 1.07E-09 | mr1248 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420802745 | NA | 5.14E-06 | mr1344 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420802745 | NA | 5.18E-06 | mr1425 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420802745 | NA | 1.56E-08 | mr1691 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420802745 | NA | 5.92E-06 | mr1704 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420802745 | NA | 2.08E-06 | mr1709 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420802745 | NA | 3.96E-06 | mr1741 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420802745 | NA | 1.86E-07 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420802745 | NA | 4.18E-07 | mr1858 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420802745 | NA | 4.19E-07 | mr1859 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420802745 | NA | 6.30E-06 | mr1889 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420802745 | NA | 4.77E-08 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420802745 | 3.61E-06 | 3.61E-06 | mr1965 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420802745 | 6.58E-06 | NA | mr1486_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |