\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420802745:

Variant ID: vg0420802745 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 20802745
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTTATTTGAGTCTTCTTTTGCTTTGTTTAATTTGGATTTGAGCATTAATTAGTTCCTATCCCTTGTCTACTTTAGATGTCAGTCCTATCCCTCGTTTGC[G/A]
AGCGCCGCCCCGAGCTTCAGAGTCGCCGCCCTTAGCTTTATCGCCTTCTTAGTCTGTTTGCTTGCTAGTTTTCGTGTTTAGGTTTGTTGCTTGTGGGTTA

Reverse complement sequence

TAACCCACAAGCAACAAACCTAAACACGAAAACTAGCAAGCAAACAGACTAAGAAGGCGATAAAGCTAAGGGCGGCGACTCTGAAGCTCGGGGCGGCGCT[C/T]
GCAAACGAGGGATAGGACTGACATCTAAAGTAGACAAGGGATAGGAACTAATTAATGCTCAAATCCAAATTAAACAAAGCAAAAGAAGACTCAAATAAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 23.80% 0.20% 18.79% 57.26% NA
All Indica  2759 2.50% 0.30% 15.91% 81.30% NA
All Japonica  1512 64.20% 0.00% 14.09% 21.69% NA
Aus  269 1.50% 0.00% 67.66% 30.86% NA
Indica I  595 1.20% 0.30% 3.70% 94.79% NA
Indica II  465 4.50% 0.60% 18.49% 76.34% NA
Indica III  913 1.40% 0.20% 22.45% 75.90% NA
Indica Intermediate  786 3.40% 0.30% 16.03% 80.28% NA
Temperate Japonica  767 82.40% 0.00% 2.09% 15.51% NA
Tropical Japonica  504 35.70% 0.00% 35.32% 28.97% NA
Japonica Intermediate  241 66.00% 0.00% 7.88% 26.14% NA
VI/Aromatic  96 44.80% 0.00% 37.50% 17.71% NA
Intermediate  90 41.10% 0.00% 20.00% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0420802745 G -> DEL N N silent_mutation Average:7.486; most accessible tissue: Callus, score: 12.278 N N N N
vg0420802745 G -> A LOC_Os04g34340.1 upstream_gene_variant ; 3675.0bp to feature; MODIFIER silent_mutation Average:7.486; most accessible tissue: Callus, score: 12.278 N N N N
vg0420802745 G -> A LOC_Os04g34350.1 upstream_gene_variant ; 275.0bp to feature; MODIFIER silent_mutation Average:7.486; most accessible tissue: Callus, score: 12.278 N N N N
vg0420802745 G -> A LOC_Os04g34340-LOC_Os04g34350 intergenic_region ; MODIFIER silent_mutation Average:7.486; most accessible tissue: Callus, score: 12.278 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0420802745 NA 2.85E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802745 2.92E-06 2.92E-06 mr1193 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802745 NA 9.69E-06 mr1205 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802745 NA 1.07E-09 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802745 NA 5.14E-06 mr1344 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802745 NA 5.18E-06 mr1425 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802745 NA 1.56E-08 mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802745 NA 5.92E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802745 NA 2.08E-06 mr1709 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802745 NA 3.96E-06 mr1741 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802745 NA 1.86E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802745 NA 4.18E-07 mr1858 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802745 NA 4.19E-07 mr1859 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802745 NA 6.30E-06 mr1889 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802745 NA 4.77E-08 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802745 3.61E-06 3.61E-06 mr1965 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802745 6.58E-06 NA mr1486_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251