\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420802623:

Variant ID: vg0420802623 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 20802623
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTATCAGTATGACTATGCATCTATTTCATGCATTAAGTTATTGTTTAGTCAGTTGCATTAGTGTCTTTTGTCTCGGTTCGTGAAAAATGTTGTTCTATGC[G/A]
TAAAAATCATCATGCTCGGTTATTTATTTGAGTCTTCTTTTGCTTTGTTTAATTTGGATTTGAGCATTAATTAGTTCCTATCCCTTGTCTACTTTAGATG

Reverse complement sequence

CATCTAAAGTAGACAAGGGATAGGAACTAATTAATGCTCAAATCCAAATTAAACAAAGCAAAAGAAGACTCAAATAAATAACCGAGCATGATGATTTTTA[C/T]
GCATAGAACAACATTTTTCACGAACCGAGACAAAAGACACTAATGCAACTGACTAAACAATAACTTAATGCATGAAATAGATGCATAGTCATACTGATAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.20% 0.10% 12.53% 58.21% NA
All Indica  2759 9.50% 0.00% 6.71% 83.80% NA
All Japonica  1512 66.20% 0.30% 14.15% 19.31% NA
Aus  269 3.00% 0.00% 61.34% 35.69% NA
Indica I  595 3.50% 0.00% 2.69% 93.78% NA
Indica II  465 13.50% 0.00% 6.45% 80.00% NA
Indica III  913 11.40% 0.00% 8.32% 80.28% NA
Indica Intermediate  786 9.40% 0.00% 8.02% 82.57% NA
Temperate Japonica  767 83.20% 0.00% 3.91% 12.91% NA
Tropical Japonica  504 37.90% 1.00% 31.94% 29.17% NA
Japonica Intermediate  241 71.40% 0.00% 9.54% 19.09% NA
VI/Aromatic  96 68.80% 0.00% 15.62% 15.62% NA
Intermediate  90 45.60% 0.00% 14.44% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0420802623 G -> DEL N N silent_mutation Average:9.104; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N
vg0420802623 G -> A LOC_Os04g34340.1 upstream_gene_variant ; 3553.0bp to feature; MODIFIER silent_mutation Average:9.104; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N
vg0420802623 G -> A LOC_Os04g34350.1 upstream_gene_variant ; 397.0bp to feature; MODIFIER silent_mutation Average:9.104; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N
vg0420802623 G -> A LOC_Os04g34340-LOC_Os04g34350 intergenic_region ; MODIFIER silent_mutation Average:9.104; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0420802623 NA 2.28E-06 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623 NA 2.63E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623 NA 7.21E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623 NA 4.62E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623 6.27E-07 6.27E-07 mr1193 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623 NA 7.04E-07 mr1205 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623 NA 1.06E-09 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623 NA 2.02E-07 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623 NA 9.08E-07 mr1295 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623 NA 9.08E-06 mr1318 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623 NA 2.98E-07 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623 NA 3.37E-06 mr1425 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623 NA 3.32E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623 NA 3.60E-09 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623 NA 3.73E-08 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623 NA 1.63E-08 mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623 NA 4.54E-06 mr1709 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623 NA 7.86E-08 mr1741 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623 NA 1.20E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623 NA 2.83E-09 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623 NA 5.09E-06 mr1768 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623 NA 3.50E-06 mr1821 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623 NA 3.57E-08 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623 NA 1.73E-07 mr1858 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623 NA 1.73E-07 mr1859 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623 NA 1.05E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251