Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420802623:

Variant ID: vg0420802623 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 20802623
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTATCAGTATGACTATGCATCTATTTCATGCATTAAGTTATTGTTTAGTCAGTTGCATTAGTGTCTTTTGTCTCGGTTCGTGAAAAATGTTGTTCTATGC[G/A]
TAAAAATCATCATGCTCGGTTATTTATTTGAGTCTTCTTTTGCTTTGTTTAATTTGGATTTGAGCATTAATTAGTTCCTATCCCTTGTCTACTTTAGATG

Reverse complement sequence

CATCTAAAGTAGACAAGGGATAGGAACTAATTAATGCTCAAATCCAAATTAAACAAAGCAAAAGAAGACTCAAATAAATAACCGAGCATGATGATTTTTA[C/T]
GCATAGAACAACATTTTTCACGAACCGAGACAAAAGACACTAATGCAACTGACTAAACAATAACTTAATGCATGAAATAGATGCATAGTCATACTGATAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	29.20%	0.10%	12.53%	58.21%	NA
All Indica	2759	9.50%	0.00%	6.71%	83.80%	NA
All Japonica	1512	66.20%	0.30%	14.15%	19.31%	NA
Aus	269	3.00%	0.00%	61.34%	35.69%	NA
Indica I	595	3.50%	0.00%	2.69%	93.78%	NA
Indica II	465	13.50%	0.00%	6.45%	80.00%	NA
Indica III	913	11.40%	0.00%	8.32%	80.28%	NA
Indica Intermediate	786	9.40%	0.00%	8.02%	82.57%	NA
Temperate Japonica	767	83.20%	0.00%	3.91%	12.91%	NA
Tropical Japonica	504	37.90%	1.00%	31.94%	29.17%	NA
Japonica Intermediate	241	71.40%	0.00%	9.54%	19.09%	NA
VI/Aromatic	96	68.80%	0.00%	15.62%	15.62%	NA
Intermediate	90	45.60%	0.00%	14.44%	40.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0420802623	G -> DEL	N	N	silent_mutation	Average:9.104; most accessible tissue: Minghui63 panicle, score: 16.27	N	N	N	N
vg0420802623	G -> A	LOC_Os04g34340.1	upstream_gene_variant ; 3553.0bp to feature; MODIFIER	silent_mutation	Average:9.104; most accessible tissue: Minghui63 panicle, score: 16.27	N	N	N	N
vg0420802623	G -> A	LOC_Os04g34350.1	upstream_gene_variant ; 397.0bp to feature; MODIFIER	silent_mutation	Average:9.104; most accessible tissue: Minghui63 panicle, score: 16.27	N	N	N	N
vg0420802623	G -> A	LOC_Os04g34340-LOC_Os04g34350	intergenic_region ; MODIFIER	silent_mutation	Average:9.104; most accessible tissue: Minghui63 panicle, score: 16.27	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0420802623	NA	2.28E-06	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623	NA	2.63E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623	NA	7.21E-06	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623	NA	4.62E-06	mr1192	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623	6.27E-07	6.27E-07	mr1193	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623	NA	7.04E-07	mr1205	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623	NA	1.06E-09	mr1248	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623	NA	2.02E-07	mr1271	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623	NA	9.08E-07	mr1295	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623	NA	9.08E-06	mr1318	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623	NA	2.98E-07	mr1403	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623	NA	3.37E-06	mr1425	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623	NA	3.32E-06	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623	NA	3.60E-09	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623	NA	3.73E-08	mr1624	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623	NA	1.63E-08	mr1691	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623	NA	4.54E-06	mr1709	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623	NA	7.86E-08	mr1741	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623	NA	1.20E-06	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623	NA	2.83E-09	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623	NA	5.09E-06	mr1768	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623	NA	3.50E-06	mr1821	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623	NA	3.57E-08	mr1825	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623	NA	1.73E-07	mr1858	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623	NA	1.73E-07	mr1859	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420802623	NA	1.05E-07	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251