Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420798136:

Variant ID: vg0420798136 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 20798136
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.72, G: 0.26, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:

TGGATGGAGCTCTCTCACAAAATGTACTAGAGTTGTGGAGCTGGATTTAGGCAGCTCCACAACGCCACTCAAGACTCAACTCCTGAAGTTATATTTAAGA[A/G]
TTGGAGCTGTACCAAACAGATCCTTAACACTCAATTTCAGATTTAACAGCTAGAAGTGGACTATACAAGTTGTAGTCATATTATTAACTGCACTGGATCC

Reverse complement sequence

GGATCCAGTGCAGTTAATAATATGACTACAACTTGTATAGTCCACTTCTAGCTGTTAAATCTGAAATTGAGTGTTAAGGATCTGTTTGGTACAGCTCCAA[T/C]
TCTTAAATATAACTTCAGGAGTTGAGTCTTGAGTGGCGTTGTGGAGCTGCCTAAATCCAGCTCCACAACTCTAGTACATTTTGTGAGAGAGCTCCATCCA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	25.00%	6.80%	0.63%	67.52%	NA
All Indica	2759	4.20%	3.70%	0.72%	91.41%	NA
All Japonica	1512	64.70%	0.20%	0.20%	34.85%	NA
Aus	269	1.90%	74.70%	0.37%	23.05%	NA
Indica I	595	2.40%	0.00%	0.67%	96.97%	NA
Indica II	465	3.20%	1.90%	0.43%	94.41%	NA
Indica III	913	5.50%	3.80%	0.55%	90.14%	NA
Indica Intermediate	786	4.70%	7.30%	1.15%	86.90%	NA
Temperate Japonica	767	82.50%	0.00%	0.13%	17.34%	NA
Tropical Japonica	504	36.70%	0.40%	0.40%	62.50%	NA
Japonica Intermediate	241	66.80%	0.40%	0.00%	32.78%	NA
VI/Aromatic	96	44.80%	12.50%	4.17%	38.54%	NA
Intermediate	90	44.40%	5.60%	2.22%	47.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0420798136	A -> DEL	N	N	silent_mutation	Average:19.634; most accessible tissue: Callus, score: 78.108	N	N	N	N
vg0420798136	A -> G	LOC_Os04g34350.1	upstream_gene_variant ; 4884.0bp to feature; MODIFIER	silent_mutation	Average:19.634; most accessible tissue: Callus, score: 78.108	N	N	N	N
vg0420798136	A -> G	LOC_Os04g34340.1	intron_variant ; MODIFIER	silent_mutation	Average:19.634; most accessible tissue: Callus, score: 78.108	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0420798136	5.74E-06	5.74E-06	mr1337	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420798136	7.85E-06	7.85E-06	mr1066_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420798136	3.97E-06	3.97E-06	mr1329_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420798136	2.17E-07	1.62E-07	mr1397_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420798136	1.17E-06	1.17E-06	mr1427_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420798136	NA	2.84E-06	mr1522_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420798136	4.78E-06	4.78E-06	mr1524_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420798136	8.49E-06	8.49E-06	mr1891_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251