| Variant ID: vg0420798136 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 20798136 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.72, G: 0.26, others allele: 0.00, population size: 53. )
TGGATGGAGCTCTCTCACAAAATGTACTAGAGTTGTGGAGCTGGATTTAGGCAGCTCCACAACGCCACTCAAGACTCAACTCCTGAAGTTATATTTAAGA[A/G]
TTGGAGCTGTACCAAACAGATCCTTAACACTCAATTTCAGATTTAACAGCTAGAAGTGGACTATACAAGTTGTAGTCATATTATTAACTGCACTGGATCC
GGATCCAGTGCAGTTAATAATATGACTACAACTTGTATAGTCCACTTCTAGCTGTTAAATCTGAAATTGAGTGTTAAGGATCTGTTTGGTACAGCTCCAA[T/C]
TCTTAAATATAACTTCAGGAGTTGAGTCTTGAGTGGCGTTGTGGAGCTGCCTAAATCCAGCTCCACAACTCTAGTACATTTTGTGAGAGAGCTCCATCCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 25.00% | 6.80% | 0.63% | 67.52% | NA |
| All Indica | 2759 | 4.20% | 3.70% | 0.72% | 91.41% | NA |
| All Japonica | 1512 | 64.70% | 0.20% | 0.20% | 34.85% | NA |
| Aus | 269 | 1.90% | 74.70% | 0.37% | 23.05% | NA |
| Indica I | 595 | 2.40% | 0.00% | 0.67% | 96.97% | NA |
| Indica II | 465 | 3.20% | 1.90% | 0.43% | 94.41% | NA |
| Indica III | 913 | 5.50% | 3.80% | 0.55% | 90.14% | NA |
| Indica Intermediate | 786 | 4.70% | 7.30% | 1.15% | 86.90% | NA |
| Temperate Japonica | 767 | 82.50% | 0.00% | 0.13% | 17.34% | NA |
| Tropical Japonica | 504 | 36.70% | 0.40% | 0.40% | 62.50% | NA |
| Japonica Intermediate | 241 | 66.80% | 0.40% | 0.00% | 32.78% | NA |
| VI/Aromatic | 96 | 44.80% | 12.50% | 4.17% | 38.54% | NA |
| Intermediate | 90 | 44.40% | 5.60% | 2.22% | 47.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0420798136 | A -> DEL | N | N | silent_mutation | Average:19.634; most accessible tissue: Callus, score: 78.108 | N | N | N | N |
| vg0420798136 | A -> G | LOC_Os04g34350.1 | upstream_gene_variant ; 4884.0bp to feature; MODIFIER | silent_mutation | Average:19.634; most accessible tissue: Callus, score: 78.108 | N | N | N | N |
| vg0420798136 | A -> G | LOC_Os04g34340.1 | intron_variant ; MODIFIER | silent_mutation | Average:19.634; most accessible tissue: Callus, score: 78.108 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0420798136 | 5.74E-06 | 5.74E-06 | mr1337 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420798136 | 7.85E-06 | 7.85E-06 | mr1066_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420798136 | 3.97E-06 | 3.97E-06 | mr1329_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420798136 | 2.17E-07 | 1.62E-07 | mr1397_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420798136 | 1.17E-06 | 1.17E-06 | mr1427_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420798136 | NA | 2.84E-06 | mr1522_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420798136 | 4.78E-06 | 4.78E-06 | mr1524_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420798136 | 8.49E-06 | 8.49E-06 | mr1891_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |