\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420788121:

Variant ID: vg0420788121 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 20788121
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCTCTTCAGTCTTCAGAATAACAGTCACACATGAATGGCTTTATTCGTGAGTTTACTGATCGCTGGTCGACGGCGTCTGAGATAAAGCTTGTGTTGGCC[C/G]
GGATGGTCGATTCATCACTTTTACTCTGAACAAGTTTGAAAGCCAGATCGACTGTTAGTTCATCATTTTGTTCTTTCTCTCTCTCTCTCTTTTTTAACAA

Reverse complement sequence

TTGTTAAAAAAGAGAGAGAGAGAGAAAGAACAAAATGATGAACTAACAGTCGATCTGGCTTTCAAACTTGTTCAGAGTAAAAGTGATGAATCGACCATCC[G/C]
GGCCAACACAAGCTTTATCTCAGACGCCGTCGACCAGCGATCAGTAAACTCACGAATAAAGCCATTCATGTGTGACTGTTATTCTGAAGACTGAAGAGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.70% 20.10% 0.04% 0.19% NA
All Indica  2759 94.70% 5.10% 0.00% 0.14% NA
All Japonica  1512 66.20% 33.70% 0.13% 0.00% NA
Aus  269 4.80% 93.30% 0.00% 1.86% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 96.30% 3.40% 0.00% 0.22% NA
Indica III  913 93.80% 5.90% 0.00% 0.33% NA
Indica Intermediate  786 91.10% 8.90% 0.00% 0.00% NA
Temperate Japonica  767 82.70% 17.30% 0.00% 0.00% NA
Tropical Japonica  504 40.70% 59.10% 0.20% 0.00% NA
Japonica Intermediate  241 67.20% 32.40% 0.41% 0.00% NA
VI/Aromatic  96 76.00% 24.00% 0.00% 0.00% NA
Intermediate  90 71.10% 28.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0420788121 C -> DEL N N silent_mutation Average:49.729; most accessible tissue: Minghui63 root, score: 74.1 N N N N
vg0420788121 C -> G LOC_Os04g34330.1 upstream_gene_variant ; 1964.0bp to feature; MODIFIER silent_mutation Average:49.729; most accessible tissue: Minghui63 root, score: 74.1 N N N N
vg0420788121 C -> G LOC_Os04g34320.1 downstream_gene_variant ; 468.0bp to feature; MODIFIER silent_mutation Average:49.729; most accessible tissue: Minghui63 root, score: 74.1 N N N N
vg0420788121 C -> G LOC_Os04g34320-LOC_Os04g34330 intergenic_region ; MODIFIER silent_mutation Average:49.729; most accessible tissue: Minghui63 root, score: 74.1 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0420788121 NA 8.84E-10 mr1029 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420788121 NA 2.14E-12 mr1047 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420788121 7.80E-06 NA mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420788121 NA 3.96E-09 mr1189 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420788121 2.89E-06 2.86E-08 mr1248 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420788121 1.46E-06 5.39E-07 mr1269 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420788121 NA 1.91E-06 mr1295 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420788121 NA 2.62E-07 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420788121 3.59E-06 NA mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420788121 NA 2.86E-06 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420788121 2.46E-06 NA mr1535 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420788121 NA 1.36E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420788121 NA 4.89E-10 mr1625 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420788121 NA 8.33E-08 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420788121 NA 8.41E-07 mr1684 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420788121 8.38E-06 NA mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420788121 NA 1.35E-07 mr1725 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420788121 1.73E-07 NA mr1768 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420788121 NA 3.08E-07 mr1768 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420788121 NA 2.25E-07 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420788121 NA 5.70E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420788121 NA 6.36E-17 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420788121 NA 1.60E-09 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420788121 NA 6.88E-11 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251