| Variant ID: vg0420788121 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 20788121 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ATCTCTTCAGTCTTCAGAATAACAGTCACACATGAATGGCTTTATTCGTGAGTTTACTGATCGCTGGTCGACGGCGTCTGAGATAAAGCTTGTGTTGGCC[C/G]
GGATGGTCGATTCATCACTTTTACTCTGAACAAGTTTGAAAGCCAGATCGACTGTTAGTTCATCATTTTGTTCTTTCTCTCTCTCTCTCTTTTTTAACAA
TTGTTAAAAAAGAGAGAGAGAGAGAAAGAACAAAATGATGAACTAACAGTCGATCTGGCTTTCAAACTTGTTCAGAGTAAAAGTGATGAATCGACCATCC[G/C]
GGCCAACACAAGCTTTATCTCAGACGCCGTCGACCAGCGATCAGTAAACTCACGAATAAAGCCATTCATGTGTGACTGTTATTCTGAAGACTGAAGAGAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.70% | 20.10% | 0.04% | 0.19% | NA |
| All Indica | 2759 | 94.70% | 5.10% | 0.00% | 0.14% | NA |
| All Japonica | 1512 | 66.20% | 33.70% | 0.13% | 0.00% | NA |
| Aus | 269 | 4.80% | 93.30% | 0.00% | 1.86% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.30% | 3.40% | 0.00% | 0.22% | NA |
| Indica III | 913 | 93.80% | 5.90% | 0.00% | 0.33% | NA |
| Indica Intermediate | 786 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 82.70% | 17.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 40.70% | 59.10% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 67.20% | 32.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 76.00% | 24.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 28.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0420788121 | C -> DEL | N | N | silent_mutation | Average:49.729; most accessible tissue: Minghui63 root, score: 74.1 | N | N | N | N |
| vg0420788121 | C -> G | LOC_Os04g34330.1 | upstream_gene_variant ; 1964.0bp to feature; MODIFIER | silent_mutation | Average:49.729; most accessible tissue: Minghui63 root, score: 74.1 | N | N | N | N |
| vg0420788121 | C -> G | LOC_Os04g34320.1 | downstream_gene_variant ; 468.0bp to feature; MODIFIER | silent_mutation | Average:49.729; most accessible tissue: Minghui63 root, score: 74.1 | N | N | N | N |
| vg0420788121 | C -> G | LOC_Os04g34320-LOC_Os04g34330 | intergenic_region ; MODIFIER | silent_mutation | Average:49.729; most accessible tissue: Minghui63 root, score: 74.1 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0420788121 | NA | 8.84E-10 | mr1029 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420788121 | NA | 2.14E-12 | mr1047 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420788121 | 7.80E-06 | NA | mr1167 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420788121 | NA | 3.96E-09 | mr1189 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420788121 | 2.89E-06 | 2.86E-08 | mr1248 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420788121 | 1.46E-06 | 5.39E-07 | mr1269 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420788121 | NA | 1.91E-06 | mr1295 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420788121 | NA | 2.62E-07 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420788121 | 3.59E-06 | NA | mr1471 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420788121 | NA | 2.86E-06 | mr1502 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/