\
| Variant ID: vg0420767744 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 20767744 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, T: 0.05, others allele: 0.00, population size: 195. )
GTCTAACAAAAAGTATTTCGAGGTACCGATATCTCAAGATACCGAATCGTTTTCAATCGTTGGAGTTAAAAACAATTTTAAAGAGTGAGGTACCGATATC[G/T]
TAAGATATTTTTTTTTCTCACCAGAGCAAATCTCATTGCTCGGCATACTTGCTGCCACTGGCTTCTGCCTTTGCCACAAAGGCACTGCTTCGCAATAATG
CATTATTGCGAAGCAGTGCCTTTGTGGCAAAGGCAGAAGCCAGTGGCAGCAAGTATGCCGAGCAATGAGATTTGCTCTGGTGAGAAAAAAAAATATCTTA[C/A]
GATATCGGTACCTCACTCTTTAAAATTGTTTTTAACTCCAACGATTGAAAACGATTCGGTATCTTGAGATATCGGTACCTCGAAATACTTTTTGTTAGAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.30% | 12.80% | 0.30% | 12.61% | NA |
| All Indica | 2759 | 85.40% | 13.40% | 0.11% | 1.09% | NA |
| All Japonica | 1512 | 66.50% | 0.60% | 0.40% | 32.54% | NA |
| Aus | 269 | 4.50% | 76.60% | 0.74% | 18.22% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.00% | 0.17% | NA |
| Indica II | 465 | 81.10% | 17.20% | 0.00% | 1.72% | NA |
| Indica III | 913 | 78.90% | 20.20% | 0.11% | 0.88% | NA |
| Indica Intermediate | 786 | 84.60% | 13.50% | 0.25% | 1.65% | NA |
| Temperate Japonica | 767 | 83.20% | 0.10% | 0.26% | 16.43% | NA |
| Tropical Japonica | 504 | 40.30% | 1.20% | 0.79% | 57.74% | NA |
| Japonica Intermediate | 241 | 68.00% | 0.80% | 0.00% | 31.12% | NA |
| VI/Aromatic | 96 | 79.20% | 12.50% | 1.04% | 7.29% | NA |
| Intermediate | 90 | 67.80% | 10.00% | 2.22% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0420767744 | G -> DEL | N | N | silent_mutation | Average:59.902; most accessible tissue: Zhenshan97 panicle, score: 80.486 | N | N | N | N |
| vg0420767744 | G -> T | LOC_Os04g34290.1 | upstream_gene_variant ; 1223.0bp to feature; MODIFIER | silent_mutation | Average:59.902; most accessible tissue: Zhenshan97 panicle, score: 80.486 | N | N | N | N |
| vg0420767744 | G -> T | LOC_Os04g34280.1 | downstream_gene_variant ; 2356.0bp to feature; MODIFIER | silent_mutation | Average:59.902; most accessible tissue: Zhenshan97 panicle, score: 80.486 | N | N | N | N |
| vg0420767744 | G -> T | LOC_Os04g34280-LOC_Os04g34290 | intergenic_region ; MODIFIER | silent_mutation | Average:59.902; most accessible tissue: Zhenshan97 panicle, score: 80.486 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0420767744 | NA | 3.18E-06 | mr1230 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420767744 | NA | 1.53E-06 | mr1319 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420767744 | NA | 5.12E-10 | mr1320 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420767744 | NA | 3.80E-07 | mr1321 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420767744 | NA | 6.92E-07 | mr1328 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420767744 | NA | 1.68E-08 | mr1348 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420767744 | NA | 4.58E-07 | mr1365 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420767744 | NA | 1.27E-07 | mr1424 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420767744 | NA | 4.97E-09 | mr1442 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420767744 | NA | 1.98E-06 | mr1545 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420767744 | NA | 5.48E-06 | mr1633 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |