\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420735370:

Variant ID: vg0420735370 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 20735370
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:


TTGTGTGGTAGATCTGTAGTAAAAAAAAATTGCTGTACAGATTGATTTGGAATTCTATTAGTGTGTTAATACCTGATGTTGCTCGAGAATGAGGCGTGGA[T/A]
AGAAAAAAAAAGGTGCTATTGGCTTCTGTGAATCACATTTTCTATGCCATTTTGTAGGGAAGAAATAGGAGTGAAGATTTCAGATCTAATCATATGGCAG

Reverse complement sequence

CTGCCATATGATTAGATCTGAAATCTTCACTCCTATTTCTTCCCTACAAAATGGCATAGAAAATGTGATTCACAGAAGCCAATAGCACCTTTTTTTTTCT[A/T]
TCCACGCCTCATTCTCGAGCAACATCAGGTATTAACACACTAATAGAATTCCAAATCAATCTGTACAGCAATTTTTTTTTACTACAGATCTACCACACAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.40% 13.50% 0.11% 0.00% NA
All Indica  2759 98.60% 1.30% 0.07% 0.00% NA
All Japonica  1512 62.20% 37.60% 0.20% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 98.30% 1.50% 0.17% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 99.10% 0.80% 0.11% 0.00% NA
Indica Intermediate  786 98.50% 1.50% 0.00% 0.00% NA
Temperate Japonica  767 30.60% 69.00% 0.39% 0.00% NA
Tropical Japonica  504 96.80% 3.20% 0.00% 0.00% NA
Japonica Intermediate  241 90.00% 10.00% 0.00% 0.00% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0420735370 T -> A LOC_Os04g34240.1 upstream_gene_variant ; 3463.0bp to feature; MODIFIER silent_mutation Average:77.796; most accessible tissue: Minghui63 flower, score: 90.103 N N N N
vg0420735370 T -> A LOC_Os04g34230.1 intron_variant ; MODIFIER silent_mutation Average:77.796; most accessible tissue: Minghui63 flower, score: 90.103 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0420735370 T A -0.02 -0.01 -0.01 -0.02 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0420735370 NA 4.78E-14 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0420735370 NA 3.10E-09 mr1629 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420735370 NA 1.61E-11 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420735370 NA 2.85E-06 mr1865 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420735370 NA 2.71E-07 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420735370 NA 3.60E-06 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420735370 NA 5.58E-07 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420735370 NA 8.70E-09 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251