\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420705057:

Variant ID: vg0420705057 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 20705057
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTTTTCCTGTTCCGTTGTAATTAGCAATCTTTACTTTCTTAATACAACAAAGATGCGTAAGTTTTTTTTCGTATTCCTGAAAAGAAAATGTAGTTCTT[A/G]
TATGAAGTTGCATGAAAATATATGAATATATAGATGAAGCCACAAAATGAAGTGTCTTAAACTCTTCTATATCATTGAGTTTGTCATATTTCAACAATTT

Reverse complement sequence

AAATTGTTGAAATATGACAAACTCAATGATATAGAAGAGTTTAAGACACTTCATTTTGTGGCTTCATCTATATATTCATATATTTTCATGCAACTTCATA[T/C]
AAGAACTACATTTTCTTTTCAGGAATACGAAAAAAAACTTACGCATCTTTGTTGTATTAAGAAAGTAAAGATTGCTAATTACAACGGAACAGGAAAAAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.00% 6.10% 5.88% 7.02% NA
All Indica  2759 76.60% 10.30% 9.79% 3.30% NA
All Japonica  1512 99.70% 0.10% 0.13% 0.07% NA
Aus  269 12.30% 0.70% 1.49% 85.50% NA
Indica I  595 79.00% 0.30% 20.67% 0.00% NA
Indica II  465 75.90% 13.80% 9.03% 1.29% NA
Indica III  913 76.20% 17.60% 1.64% 4.49% NA
Indica Intermediate  786 75.70% 7.30% 11.45% 5.60% NA
Temperate Japonica  767 99.70% 0.10% 0.13% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.00% 0.20% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 90.60% 0.00% 0.00% 9.38% NA
Intermediate  90 96.70% 0.00% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0420705057 A -> DEL N N silent_mutation Average:43.646; most accessible tissue: Callus, score: 89.046 N N N N
vg0420705057 A -> G LOC_Os04g34170.1 upstream_gene_variant ; 2976.0bp to feature; MODIFIER silent_mutation Average:43.646; most accessible tissue: Callus, score: 89.046 N N N N
vg0420705057 A -> G LOC_Os04g34170.3 upstream_gene_variant ; 2976.0bp to feature; MODIFIER silent_mutation Average:43.646; most accessible tissue: Callus, score: 89.046 N N N N
vg0420705057 A -> G LOC_Os04g34160.1 downstream_gene_variant ; 1208.0bp to feature; MODIFIER silent_mutation Average:43.646; most accessible tissue: Callus, score: 89.046 N N N N
vg0420705057 A -> G LOC_Os04g34160-LOC_Os04g34170 intergenic_region ; MODIFIER silent_mutation Average:43.646; most accessible tissue: Callus, score: 89.046 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0420705057 4.32E-06 5.22E-07 mr1042_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420705057 NA 6.18E-06 mr1457_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420705057 8.39E-06 3.32E-06 mr1677_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251