Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420689698:

Variant ID: vg0420689698 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 20689698
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGACTATATTTGATTAACGGTCATAATATATATGTATGACTATATTTGATTAACGGTTATAATATATATGAACATACGCTCTTTTAGTTGATTTATGGT[T/A]
GTATGTCTCTAATTGTACATGACTTATATAATTAGATCGTATGTATAGCAGTACTCTTTTCGGACCTCGAACTCAGGCCTTGTTTAGTTTCTAAAACAAA

Reverse complement sequence

TTTGTTTTAGAAACTAAACAAGGCCTGAGTTCGAGGTCCGAAAAGAGTACTGCTATACATACGATCTAATTATATAAGTCATGTACAATTAGAGACATAC[A/T]
ACCATAAATCAACTAAAAGAGCGTATGTTCATATATATTATAACCGTTAATCAAATATAGTCATACATATATATTATGACCGTTAATCAAATATAGTCAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.50%	10.30%	0.19%	0.00%	NA
All Indica	2759	98.00%	1.90%	0.11%	0.00%	NA
All Japonica	1512	78.00%	21.80%	0.13%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	95.50%	4.40%	0.17%	0.00%	NA
Indica II	465	98.90%	0.60%	0.43%	0.00%	NA
Indica III	913	99.50%	0.50%	0.00%	0.00%	NA
Indica Intermediate	786	97.70%	2.30%	0.00%	0.00%	NA
Temperate Japonica	767	88.70%	11.30%	0.00%	0.00%	NA
Tropical Japonica	504	63.30%	36.70%	0.00%	0.00%	NA
Japonica Intermediate	241	75.10%	24.10%	0.83%	0.00%	NA
VI/Aromatic	96	11.50%	87.50%	1.04%	0.00%	NA
Intermediate	90	76.70%	20.00%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0420689698	T -> A	LOC_Os04g34130.1	upstream_gene_variant ; 1296.0bp to feature; MODIFIER	silent_mutation	Average:46.242; most accessible tissue: Minghui63 young leaf, score: 63.571	N	N	N	N
vg0420689698	T -> A	LOC_Os04g34140.1	upstream_gene_variant ; 1156.0bp to feature; MODIFIER	silent_mutation	Average:46.242; most accessible tissue: Minghui63 young leaf, score: 63.571	N	N	N	N
vg0420689698	T -> A	LOC_Os04g34130-LOC_Os04g34140	intergenic_region ; MODIFIER	silent_mutation	Average:46.242; most accessible tissue: Minghui63 young leaf, score: 63.571	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0420689698	4.52E-06	NA	mr1416	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420689698	2.14E-06	NA	mr1883	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420689698	2.30E-06	2.30E-06	mr1883	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420689698	NA	3.84E-06	mr1695_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251