RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0420667247:

Variant ID: vg0420667247 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 20667247
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.85, T: 0.15, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

TTCCTATATGGACTCTATACTCTACTTCTAATATTCCTTATTTTTTAATTCCGAATTTCTATTTTTTTTCTTAATTGTATTTCTATATGGACTATATACT[C/T]
TACTTCTAATATTCTTTATTTTTAATTCCGAATTTCTATTATTTCCTAATTGTATTTCTATATGGACTCTATACTCTACTTCTAATTTTCCTTATTTTTA

Reverse complement sequence

TAAAAATAAGGAAAATTAGAAGTAGAGTATAGAGTCCATATAGAAATACAATTAGGAAATAATAGAAATTCGGAATTAAAAATAAAGAATATTAGAAGTA[G/A]
AGTATATAGTCCATATAGAAATACAATTAAGAAAAAAAATAGAAATTCGGAATTAAAAAATAAGGAATATTAGAAGTAGAGTATAGAGTCCATATAGGAA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.60%	17.90%	0.49%	0.02%	NA
All Indica	2759	97.20%	2.40%	0.40%	0.00%	NA
All Japonica	1512	56.90%	42.90%	0.13%	0.00%	NA
Aus	269	92.60%	6.70%	0.37%	0.37%	NA
Indica I	595	95.50%	4.00%	0.50%	0.00%	NA
Indica II	465	96.30%	3.00%	0.65%	0.00%	NA
Indica III	913	99.30%	0.50%	0.11%	0.00%	NA
Indica Intermediate	786	96.40%	3.10%	0.51%	0.00%	NA
Temperate Japonica	767	86.20%	13.80%	0.00%	0.00%	NA
Tropical Japonica	504	9.50%	90.30%	0.20%	0.00%	NA
Japonica Intermediate	241	63.10%	36.50%	0.41%	0.00%	NA
VI/Aromatic	96	10.40%	86.50%	3.12%	0.00%	NA
Intermediate	90	61.10%	32.20%	6.67%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0420667247	C -> DEL	N	N	silent_mutation	Average:19.955; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0420667247	C -> T	LOC_Os04g34100-LOC_Os04g34110	intergenic_region ; MODIFIER	silent_mutation	Average:19.955; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0420667247	NA	1.71E-08	mr1308	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420667247	NA	2.70E-06	mr1388	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420667247	NA	2.60E-06	mr1388	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420667247	2.39E-06	NA	mr1416	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420667247	NA	3.42E-09	mr1554	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420667247	NA	6.72E-06	mr1578	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420667247	NA	3.12E-07	mr1584	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420667247	1.43E-06	1.04E-08	mr1602	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420667247	NA	4.29E-07	mr1602	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420667247	NA	7.58E-06	mr1740	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 18 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0420667247:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact