\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420667247:

Variant ID: vg0420667247 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 20667247
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.85, T: 0.15, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


TTCCTATATGGACTCTATACTCTACTTCTAATATTCCTTATTTTTTAATTCCGAATTTCTATTTTTTTTCTTAATTGTATTTCTATATGGACTATATACT[C/T]
TACTTCTAATATTCTTTATTTTTAATTCCGAATTTCTATTATTTCCTAATTGTATTTCTATATGGACTCTATACTCTACTTCTAATTTTCCTTATTTTTA

Reverse complement sequence

TAAAAATAAGGAAAATTAGAAGTAGAGTATAGAGTCCATATAGAAATACAATTAGGAAATAATAGAAATTCGGAATTAAAAATAAAGAATATTAGAAGTA[G/A]
AGTATATAGTCCATATAGAAATACAATTAAGAAAAAAAATAGAAATTCGGAATTAAAAAATAAGGAATATTAGAAGTAGAGTATAGAGTCCATATAGGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.60% 17.90% 0.49% 0.02% NA
All Indica  2759 97.20% 2.40% 0.40% 0.00% NA
All Japonica  1512 56.90% 42.90% 0.13% 0.00% NA
Aus  269 92.60% 6.70% 0.37% 0.37% NA
Indica I  595 95.50% 4.00% 0.50% 0.00% NA
Indica II  465 96.30% 3.00% 0.65% 0.00% NA
Indica III  913 99.30% 0.50% 0.11% 0.00% NA
Indica Intermediate  786 96.40% 3.10% 0.51% 0.00% NA
Temperate Japonica  767 86.20% 13.80% 0.00% 0.00% NA
Tropical Japonica  504 9.50% 90.30% 0.20% 0.00% NA
Japonica Intermediate  241 63.10% 36.50% 0.41% 0.00% NA
VI/Aromatic  96 10.40% 86.50% 3.12% 0.00% NA
Intermediate  90 61.10% 32.20% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0420667247 C -> DEL N N silent_mutation Average:19.955; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0420667247 C -> T LOC_Os04g34100-LOC_Os04g34110 intergenic_region ; MODIFIER silent_mutation Average:19.955; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0420667247 NA 1.71E-08 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420667247 NA 2.70E-06 mr1388 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420667247 NA 2.60E-06 mr1388 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420667247 2.39E-06 NA mr1416 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420667247 NA 3.42E-09 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420667247 NA 6.72E-06 mr1578 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420667247 NA 3.12E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420667247 1.43E-06 1.04E-08 mr1602 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420667247 NA 4.29E-07 mr1602 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420667247 NA 7.58E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420667247 NA 5.80E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420667247 7.23E-06 4.23E-12 mr1388_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420667247 NA 1.68E-06 mr1388_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420667247 NA 1.88E-16 mr1416_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420667247 NA 5.79E-06 mr1416_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420667247 NA 1.92E-09 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420667247 NA 3.06E-06 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420667247 NA 1.36E-08 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251