\
| Variant ID: vg0420667247 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 20667247 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.85, T: 0.15, others allele: 0.00, population size: 105. )
TTCCTATATGGACTCTATACTCTACTTCTAATATTCCTTATTTTTTAATTCCGAATTTCTATTTTTTTTCTTAATTGTATTTCTATATGGACTATATACT[C/T]
TACTTCTAATATTCTTTATTTTTAATTCCGAATTTCTATTATTTCCTAATTGTATTTCTATATGGACTCTATACTCTACTTCTAATTTTCCTTATTTTTA
TAAAAATAAGGAAAATTAGAAGTAGAGTATAGAGTCCATATAGAAATACAATTAGGAAATAATAGAAATTCGGAATTAAAAATAAAGAATATTAGAAGTA[G/A]
AGTATATAGTCCATATAGAAATACAATTAAGAAAAAAAATAGAAATTCGGAATTAAAAAATAAGGAATATTAGAAGTAGAGTATAGAGTCCATATAGGAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.60% | 17.90% | 0.49% | 0.02% | NA |
| All Indica | 2759 | 97.20% | 2.40% | 0.40% | 0.00% | NA |
| All Japonica | 1512 | 56.90% | 42.90% | 0.13% | 0.00% | NA |
| Aus | 269 | 92.60% | 6.70% | 0.37% | 0.37% | NA |
| Indica I | 595 | 95.50% | 4.00% | 0.50% | 0.00% | NA |
| Indica II | 465 | 96.30% | 3.00% | 0.65% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 96.40% | 3.10% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 86.20% | 13.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 9.50% | 90.30% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 63.10% | 36.50% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 10.40% | 86.50% | 3.12% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 32.20% | 6.67% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0420667247 | C -> DEL | N | N | silent_mutation | Average:19.955; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0420667247 | C -> T | LOC_Os04g34100-LOC_Os04g34110 | intergenic_region ; MODIFIER | silent_mutation | Average:19.955; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0420667247 | NA | 1.71E-08 | mr1308 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420667247 | NA | 2.70E-06 | mr1388 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420667247 | NA | 2.60E-06 | mr1388 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420667247 | 2.39E-06 | NA | mr1416 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420667247 | NA | 3.42E-09 | mr1554 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420667247 | NA | 6.72E-06 | mr1578 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420667247 | NA | 3.12E-07 | mr1584 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420667247 | 1.43E-06 | 1.04E-08 | mr1602 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420667247 | NA | 4.29E-07 | mr1602 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420667247 | NA | 7.58E-06 | mr1740 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420667247 | NA | 5.80E-06 | mr1942 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420667247 | 7.23E-06 | 4.23E-12 | mr1388_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420667247 | NA | 1.68E-06 | mr1388_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420667247 | NA | 1.88E-16 | mr1416_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420667247 | NA | 5.79E-06 | mr1416_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420667247 | NA | 1.92E-09 | mr1554_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420667247 | NA | 3.06E-06 | mr1554_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420667247 | NA | 1.36E-08 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |