\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420626346:

Variant ID: vg0420626346 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 20626346
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.77, T: 0.23, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


ATTGTGGATAATAAAGTAAGTCACAAATAAAATAAACAATAATTTTAAAAAATTTTGAATAAAACGAGTGGTTAAACGTTATAAGCAAAAACTTAAAATC[T/C]
CTTATATTATGGAACGGAGGGAGTATCACTACTAGTACTATGTTTCTTGTGATTAAATTGTGTGATGTTTGTGTGTGGACTGACCGTGTCAGTGGTAGCA

Reverse complement sequence

TGCTACCACTGACACGGTCAGTCCACACACAAACATCACACAATTTAATCACAAGAAACATAGTACTAGTAGTGATACTCCCTCCGTTCCATAATATAAG[A/G]
GATTTTAAGTTTTTGCTTATAACGTTTAACCACTCGTTTTATTCAAAATTTTTTAAAATTATTGTTTATTTTATTTGTGACTTACTTTATTATCCACAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.20% 25.60% 0.13% 0.00% NA
All Indica  2759 98.10% 1.80% 0.07% 0.00% NA
All Japonica  1512 25.80% 74.10% 0.07% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 95.30% 4.50% 0.22% 0.00% NA
Indica III  913 98.90% 1.10% 0.00% 0.00% NA
Indica Intermediate  786 97.80% 2.00% 0.13% 0.00% NA
Temperate Japonica  767 8.20% 91.80% 0.00% 0.00% NA
Tropical Japonica  504 46.20% 53.60% 0.20% 0.00% NA
Japonica Intermediate  241 39.00% 61.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 56.70% 40.00% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0420626346 T -> C LOC_Os04g34040.1 upstream_gene_variant ; 4992.0bp to feature; MODIFIER silent_mutation Average:96.607; most accessible tissue: Zhenshan97 flag leaf, score: 98.551 N N N N
vg0420626346 T -> C LOC_Os04g34050.1 downstream_gene_variant ; 427.0bp to feature; MODIFIER silent_mutation Average:96.607; most accessible tissue: Zhenshan97 flag leaf, score: 98.551 N N N N
vg0420626346 T -> C LOC_Os04g34060.1 downstream_gene_variant ; 1235.0bp to feature; MODIFIER silent_mutation Average:96.607; most accessible tissue: Zhenshan97 flag leaf, score: 98.551 N N N N
vg0420626346 T -> C LOC_Os04g34070.1 downstream_gene_variant ; 3686.0bp to feature; MODIFIER silent_mutation Average:96.607; most accessible tissue: Zhenshan97 flag leaf, score: 98.551 N N N N
vg0420626346 T -> C LOC_Os04g34050-LOC_Os04g34060 intergenic_region ; MODIFIER silent_mutation Average:96.607; most accessible tissue: Zhenshan97 flag leaf, score: 98.551 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0420626346 T C -0.02 0.0 0.0 -0.01 -0.01 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0420626346 NA 1.20E-11 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626346 NA 4.84E-10 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626346 NA 7.06E-12 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626346 NA 9.80E-07 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626346 NA 2.18E-13 mr1853 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626346 NA 3.14E-15 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626346 NA 3.02E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626346 NA 1.66E-13 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626346 NA 1.77E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626346 NA 1.33E-11 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626346 NA 8.62E-23 mr1308_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626346 NA 4.55E-07 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626346 NA 8.20E-09 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626346 4.22E-07 NA mr1554_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626346 4.82E-06 9.20E-09 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626346 NA 1.09E-28 mr1584_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626346 NA 9.73E-08 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626346 NA 2.70E-08 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626346 NA 9.43E-09 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626346 NA 7.86E-12 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626346 NA 1.51E-21 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626346 NA 6.63E-20 mr1730_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626346 NA 2.64E-15 mr1853_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626346 NA 4.36E-06 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626346 NA 1.20E-17 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626346 NA 9.22E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251