\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420626339:

Variant ID: vg0420626339 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 20626339
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.66, C: 0.33, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


TTAAAGTATTGTGGATAATAAAGTAAGTCACAAATAAAATAAACAATAATTTTAAAAAATTTTGAATAAAACGAGTGGTTAAACGTTATAAGCAAAAACT[T/C]
AAAATCTCTTATATTATGGAACGGAGGGAGTATCACTACTAGTACTATGTTTCTTGTGATTAAATTGTGTGATGTTTGTGTGTGGACTGACCGTGTCAGT

Reverse complement sequence

ACTGACACGGTCAGTCCACACACAAACATCACACAATTTAATCACAAGAAACATAGTACTAGTAGTGATACTCCCTCCGTTCCATAATATAAGAGATTTT[A/G]
AGTTTTTGCTTATAACGTTTAACCACTCGTTTTATTCAAAATTTTTTAAAATTATTGTTTATTTTATTTGTGACTTACTTTATTATCCACAATACTTTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.00% 33.70% 0.36% 0.00% NA
All Indica  2759 94.20% 5.60% 0.22% 0.00% NA
All Japonica  1512 24.80% 75.00% 0.20% 0.00% NA
Aus  269 3.70% 95.90% 0.37% 0.00% NA
Indica I  595 99.30% 0.50% 0.17% 0.00% NA
Indica II  465 93.30% 6.50% 0.22% 0.00% NA
Indica III  913 93.90% 6.00% 0.11% 0.00% NA
Indica Intermediate  786 91.20% 8.40% 0.38% 0.00% NA
Temperate Japonica  767 8.20% 91.80% 0.00% 0.00% NA
Tropical Japonica  504 44.80% 54.80% 0.40% 0.00% NA
Japonica Intermediate  241 35.70% 63.90% 0.41% 0.00% NA
VI/Aromatic  96 88.50% 11.50% 0.00% 0.00% NA
Intermediate  90 53.30% 38.90% 7.78% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0420626339 T -> C LOC_Os04g34040.1 upstream_gene_variant ; 4985.0bp to feature; MODIFIER silent_mutation Average:96.676; most accessible tissue: Zhenshan97 flag leaf, score: 98.568 N N N N
vg0420626339 T -> C LOC_Os04g34050.1 downstream_gene_variant ; 420.0bp to feature; MODIFIER silent_mutation Average:96.676; most accessible tissue: Zhenshan97 flag leaf, score: 98.568 N N N N
vg0420626339 T -> C LOC_Os04g34060.1 downstream_gene_variant ; 1242.0bp to feature; MODIFIER silent_mutation Average:96.676; most accessible tissue: Zhenshan97 flag leaf, score: 98.568 N N N N
vg0420626339 T -> C LOC_Os04g34070.1 downstream_gene_variant ; 3693.0bp to feature; MODIFIER silent_mutation Average:96.676; most accessible tissue: Zhenshan97 flag leaf, score: 98.568 N N N N
vg0420626339 T -> C LOC_Os04g34050-LOC_Os04g34060 intergenic_region ; MODIFIER silent_mutation Average:96.676; most accessible tissue: Zhenshan97 flag leaf, score: 98.568 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0420626339 T C -0.01 -0.01 0.01 0.0 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0420626339 NA 2.85E-14 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626339 NA 3.29E-13 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626339 NA 3.30E-13 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626339 NA 2.54E-13 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626339 NA 5.83E-13 mr1169 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626339 NA 8.11E-13 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626339 NA 8.60E-08 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626339 NA 3.66E-07 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626339 NA 8.66E-09 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626339 NA 2.27E-08 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626339 NA 6.89E-09 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626339 NA 8.69E-12 mr1938 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626339 NA 1.11E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626339 NA 4.55E-07 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626339 NA 9.07E-25 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626339 NA 2.84E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626339 1.35E-06 NA mr1554_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626339 4.82E-06 9.20E-09 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626339 NA 1.49E-13 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626339 NA 4.36E-06 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626339 NA 5.35E-09 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626339 NA 7.72E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420626339 NA 2.04E-09 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251