Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420624109:

Variant ID: vg0420624109 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 20624109
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


CTAGAAATATATTCATTAATATCAATATGAATGTGGGAAATGTTAGTATGACTTACATTGTGAAACGAATGAAGTACTATTTTGTAAGAATATTTCTACG[A/G]
AAAATGCTACAGGATGGTGCCCCGTATTCTCGTTCAGACGGAATGATGCCTCTGAGTTATCGTCGGATACTTATTAGGTATCGATCGATACCCTATTTAG

Reverse complement sequence

CTAAATAGGGTATCGATCGATACCTAATAAGTATCCGACGATAACTCAGAGGCATCATTCCGTCTGAACGAGAATACGGGGCACCATCCTGTAGCATTTT[T/C]
CGTAGAAATATTCTTACAAAATAGTACTTCATTCGTTTCACAATGTAAGTCATACTAACATTTCCCACATTCATATTGATATTAATGAATATATTTCTAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.60% 25.30% 0.11% 0.00% NA
All Indica  2759 98.40% 1.50% 0.04% 0.00% NA
All Japonica  1512 25.90% 74.00% 0.13% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 95.30% 4.70% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 98.00% 1.90% 0.13% 0.00% NA
Temperate Japonica  767 8.30% 91.70% 0.00% 0.00% NA
Tropical Japonica  504 46.40% 53.40% 0.20% 0.00% NA
Japonica Intermediate  241 38.60% 61.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 61.10% 36.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0420624109 A -> G LOC_Os04g34040.1 upstream_gene_variant ; 2755.0bp to feature; MODIFIER silent_mutation Average:85.154; most accessible tissue: Minghui63 panicle, score: 93.176 N N N N
vg0420624109 A -> G LOC_Os04g34050.1 upstream_gene_variant ; 489.0bp to feature; MODIFIER silent_mutation Average:85.154; most accessible tissue: Minghui63 panicle, score: 93.176 N N N N
vg0420624109 A -> G LOC_Os04g34060.1 downstream_gene_variant ; 3472.0bp to feature; MODIFIER silent_mutation Average:85.154; most accessible tissue: Minghui63 panicle, score: 93.176 N N N N
vg0420624109 A -> G LOC_Os04g34040-LOC_Os04g34050 intergenic_region ; MODIFIER silent_mutation Average:85.154; most accessible tissue: Minghui63 panicle, score: 93.176 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0420624109 A G -0.02 -0.03 -0.03 -0.01 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0420624109 NA 1.58E-06 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420624109 NA 1.46E-13 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420624109 NA 5.00E-13 mr1853 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420624109 NA 8.32E-08 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420624109 4.01E-06 6.03E-09 mr1554_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420624109 NA 4.18E-27 mr1584_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420624109 NA 2.82E-08 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420624109 NA 1.13E-10 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420624109 NA 6.46E-18 mr1730_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420624109 NA 7.76E-16 mr1790_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420624109 NA 5.49E-44 mr1805_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420624109 NA 9.93E-13 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420624109 NA 1.92E-15 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251