\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420583670:

Variant ID: vg0420583670 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 20583670
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.75, A: 0.25, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


GAGTTTCGGATAAGGAAATACAACCAGAGTTCTACATGGAAACGACAAGGACTACTCGGATTGTATCCATAATGGTTTCCCTAGTTCTACTTGGACAAGG[A/G]
GACACCTATGGGTATAAATACAAGGCCCCCTAGGAGGAGAGGGGACACACTCAACATAGACGGAACAACAGAAGCCACAAGACAACATACGCCAAGAAAA

Reverse complement sequence

TTTTCTTGGCGTATGTTGTCTTGTGGCTTCTGTTGTTCCGTCTATGTTGAGTGTGTCCCCTCTCCTCCTAGGGGGCCTTGTATTTATACCCATAGGTGTC[T/C]
CCTTGTCCAAGTAGAACTAGGGAAACCATTATGGATACAATCCGAGTAGTCCTTGTCGTTTCCATGTAGAACTCTGGTTGTATTTCCTTATCCGAAACTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.20% 27.20% 0.59% 0.00% NA
All Indica  2759 85.20% 14.20% 0.58% 0.00% NA
All Japonica  1512 48.70% 50.90% 0.46% 0.00% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 87.10% 12.30% 0.65% 0.00% NA
Indica III  913 74.60% 24.40% 0.99% 0.00% NA
Indica Intermediate  786 86.10% 13.40% 0.51% 0.00% NA
Temperate Japonica  767 85.30% 14.20% 0.52% 0.00% NA
Tropical Japonica  504 2.00% 97.60% 0.40% 0.00% NA
Japonica Intermediate  241 29.90% 69.70% 0.41% 0.00% NA
VI/Aromatic  96 14.60% 85.40% 0.00% 0.00% NA
Intermediate  90 52.20% 42.20% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0420583670 A -> G LOC_Os04g33990.1 upstream_gene_variant ; 3137.0bp to feature; MODIFIER silent_mutation Average:63.105; most accessible tissue: Minghui63 panicle, score: 81.412 N N N N
vg0420583670 A -> G LOC_Os04g34000.1 upstream_gene_variant ; 3348.0bp to feature; MODIFIER silent_mutation Average:63.105; most accessible tissue: Minghui63 panicle, score: 81.412 N N N N
vg0420583670 A -> G LOC_Os04g33990-LOC_Os04g34000 intergenic_region ; MODIFIER silent_mutation Average:63.105; most accessible tissue: Minghui63 panicle, score: 81.412 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0420583670 NA 3.21E-11 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0420583670 NA 1.10E-12 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420583670 NA 6.16E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420583670 NA 7.64E-06 mr1388_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420583670 NA 2.28E-07 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420583670 NA 3.71E-06 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420583670 4.23E-06 4.21E-06 mr1760_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420583670 NA 4.31E-08 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420583670 NA 3.17E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251