Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420583670:

Variant ID: vg0420583670 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 20583670
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.75, A: 0.25, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:

GAGTTTCGGATAAGGAAATACAACCAGAGTTCTACATGGAAACGACAAGGACTACTCGGATTGTATCCATAATGGTTTCCCTAGTTCTACTTGGACAAGG[A/G]
GACACCTATGGGTATAAATACAAGGCCCCCTAGGAGGAGAGGGGACACACTCAACATAGACGGAACAACAGAAGCCACAAGACAACATACGCCAAGAAAA

Reverse complement sequence

TTTTCTTGGCGTATGTTGTCTTGTGGCTTCTGTTGTTCCGTCTATGTTGAGTGTGTCCCCTCTCCTCCTAGGGGGCCTTGTATTTATACCCATAGGTGTC[T/C]
CCTTGTCCAAGTAGAACTAGGGAAACCATTATGGATACAATCCGAGTAGTCCTTGTCGTTTCCATGTAGAACTCTGGTTGTATTTCCTTATCCGAAACTC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.20%	27.20%	0.59%	0.00%	NA
All Indica	2759	85.20%	14.20%	0.58%	0.00%	NA
All Japonica	1512	48.70%	50.90%	0.46%	0.00%	NA
Aus	269	98.10%	1.90%	0.00%	0.00%	NA
Indica I	595	98.80%	1.20%	0.00%	0.00%	NA
Indica II	465	87.10%	12.30%	0.65%	0.00%	NA
Indica III	913	74.60%	24.40%	0.99%	0.00%	NA
Indica Intermediate	786	86.10%	13.40%	0.51%	0.00%	NA
Temperate Japonica	767	85.30%	14.20%	0.52%	0.00%	NA
Tropical Japonica	504	2.00%	97.60%	0.40%	0.00%	NA
Japonica Intermediate	241	29.90%	69.70%	0.41%	0.00%	NA
VI/Aromatic	96	14.60%	85.40%	0.00%	0.00%	NA
Intermediate	90	52.20%	42.20%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0420583670	A -> G	LOC_Os04g33990.1	upstream_gene_variant ; 3137.0bp to feature; MODIFIER	silent_mutation	Average:63.105; most accessible tissue: Minghui63 panicle, score: 81.412	N	N	N	N
vg0420583670	A -> G	LOC_Os04g34000.1	upstream_gene_variant ; 3348.0bp to feature; MODIFIER	silent_mutation	Average:63.105; most accessible tissue: Minghui63 panicle, score: 81.412	N	N	N	N
vg0420583670	A -> G	LOC_Os04g33990-LOC_Os04g34000	intergenic_region ; MODIFIER	silent_mutation	Average:63.105; most accessible tissue: Minghui63 panicle, score: 81.412	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0420583670	NA	3.21E-11	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0420583670	NA	1.10E-12	mr1521	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420583670	NA	6.16E-06	mr1740	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420583670	NA	7.64E-06	mr1388_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420583670	NA	2.28E-07	mr1554_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420583670	NA	3.71E-06	mr1554_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420583670	4.23E-06	4.21E-06	mr1760_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420583670	NA	4.31E-08	mr1794_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420583670	NA	3.17E-08	mr1952_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251