\
| Variant ID: vg0420583670 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 20583670 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.75, A: 0.25, others allele: 0.00, population size: 209. )
GAGTTTCGGATAAGGAAATACAACCAGAGTTCTACATGGAAACGACAAGGACTACTCGGATTGTATCCATAATGGTTTCCCTAGTTCTACTTGGACAAGG[A/G]
GACACCTATGGGTATAAATACAAGGCCCCCTAGGAGGAGAGGGGACACACTCAACATAGACGGAACAACAGAAGCCACAAGACAACATACGCCAAGAAAA
TTTTCTTGGCGTATGTTGTCTTGTGGCTTCTGTTGTTCCGTCTATGTTGAGTGTGTCCCCTCTCCTCCTAGGGGGCCTTGTATTTATACCCATAGGTGTC[T/C]
CCTTGTCCAAGTAGAACTAGGGAAACCATTATGGATACAATCCGAGTAGTCCTTGTCGTTTCCATGTAGAACTCTGGTTGTATTTCCTTATCCGAAACTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.20% | 27.20% | 0.59% | 0.00% | NA |
| All Indica | 2759 | 85.20% | 14.20% | 0.58% | 0.00% | NA |
| All Japonica | 1512 | 48.70% | 50.90% | 0.46% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 87.10% | 12.30% | 0.65% | 0.00% | NA |
| Indica III | 913 | 74.60% | 24.40% | 0.99% | 0.00% | NA |
| Indica Intermediate | 786 | 86.10% | 13.40% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 85.30% | 14.20% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 2.00% | 97.60% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 29.90% | 69.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 14.60% | 85.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 52.20% | 42.20% | 5.56% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0420583670 | A -> G | LOC_Os04g33990.1 | upstream_gene_variant ; 3137.0bp to feature; MODIFIER | silent_mutation | Average:63.105; most accessible tissue: Minghui63 panicle, score: 81.412 | N | N | N | N |
| vg0420583670 | A -> G | LOC_Os04g34000.1 | upstream_gene_variant ; 3348.0bp to feature; MODIFIER | silent_mutation | Average:63.105; most accessible tissue: Minghui63 panicle, score: 81.412 | N | N | N | N |
| vg0420583670 | A -> G | LOC_Os04g33990-LOC_Os04g34000 | intergenic_region ; MODIFIER | silent_mutation | Average:63.105; most accessible tissue: Minghui63 panicle, score: 81.412 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0420583670 | NA | 3.21E-11 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0420583670 | NA | 1.10E-12 | mr1521 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420583670 | NA | 6.16E-06 | mr1740 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420583670 | NA | 7.64E-06 | mr1388_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420583670 | NA | 2.28E-07 | mr1554_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420583670 | NA | 3.71E-06 | mr1554_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420583670 | 4.23E-06 | 4.21E-06 | mr1760_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420583670 | NA | 4.31E-08 | mr1794_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420583670 | NA | 3.17E-08 | mr1952_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |