\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420556306:

Variant ID: vg0420556306 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 20556306
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGGAGCGGCAACGGGTCGTGGAGGTGGCGGCGTCTGGTCATGGCGGAGTGCCGGCGGTCGCGGAGGTGGCAGCAGGTGTGAACAACGATGGCGGATGCA[G/A]
AGGCAAGTTGACGCCGTGTGCTACATCCAAGTGGGATGAGTTCGTCCGGCCGATTTTGCCGGATGGCTTGGTCCCAAATTTGAGAGGAATATTCATCTAT

Reverse complement sequence

ATAGATGAATATTCCTCTCAAATTTGGGACCAAGCCATCCGGCAAAATCGGCCGGACGAACTCATCCCACTTGGATGTAGCACACGGCGTCAACTTGCCT[C/T]
TGCATCCGCCATCGTTGTTCACACCTGCTGCCACCTCCGCGACCGCCGGCACTCCGCCATGACCAGACGCCGCCACCTCCACGACCCGTTGCCGCTCCTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.50% 9.00% 1.52% 0.00% NA
All Indica  2759 98.40% 1.40% 0.18% 0.00% NA
All Japonica  1512 73.90% 22.10% 4.03% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.20% 0.17% 0.00% NA
Indica II  465 97.60% 1.90% 0.43% 0.00% NA
Indica III  913 99.10% 0.80% 0.11% 0.00% NA
Indica Intermediate  786 97.20% 2.70% 0.13% 0.00% NA
Temperate Japonica  767 93.60% 3.50% 2.87% 0.00% NA
Tropical Japonica  504 57.50% 39.30% 3.17% 0.00% NA
Japonica Intermediate  241 45.20% 45.20% 9.54% 0.00% NA
VI/Aromatic  96 50.00% 45.80% 4.17% 0.00% NA
Intermediate  90 86.70% 11.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0420556306 G -> A LOC_Os04g33950.1 upstream_gene_variant ; 1002.0bp to feature; MODIFIER silent_mutation Average:66.737; most accessible tissue: Callus, score: 83.629 N N N N
vg0420556306 G -> A LOC_Os04g33960.1 upstream_gene_variant ; 927.0bp to feature; MODIFIER silent_mutation Average:66.737; most accessible tissue: Callus, score: 83.629 N N N N
vg0420556306 G -> A LOC_Os04g33970.1 upstream_gene_variant ; 3660.0bp to feature; MODIFIER silent_mutation Average:66.737; most accessible tissue: Callus, score: 83.629 N N N N
vg0420556306 G -> A LOC_Os04g33950-LOC_Os04g33960 intergenic_region ; MODIFIER silent_mutation Average:66.737; most accessible tissue: Callus, score: 83.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0420556306 NA 1.42E-06 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420556306 NA 2.49E-06 mr1041 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420556306 NA 6.86E-07 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420556306 7.68E-06 7.68E-06 mr1054 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420556306 NA 7.97E-07 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420556306 5.96E-07 NA mr1057 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420556306 NA 2.87E-11 mr1084 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420556306 NA 5.66E-13 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420556306 NA 4.34E-06 mr1205 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420556306 NA 5.33E-07 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420556306 NA 3.15E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420556306 1.54E-06 1.54E-06 mr1254 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420556306 NA 5.59E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420556306 NA 4.57E-06 mr1287 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420556306 NA 7.22E-07 mr1295 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420556306 NA 6.93E-06 mr1319 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420556306 NA 6.23E-06 mr1372 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420556306 1.17E-06 1.17E-06 mr1372 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420556306 NA 3.88E-06 mr1405 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420556306 7.75E-06 NA mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420556306 2.57E-06 2.57E-06 mr1432 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420556306 NA 2.88E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420556306 5.48E-06 NA mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420556306 NA 5.42E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420556306 NA 1.13E-08 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420556306 NA 4.24E-06 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420556306 NA 5.47E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420556306 NA 1.82E-07 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420556306 NA 4.59E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420556306 NA 1.24E-06 mr1851 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420556306 NA 6.76E-12 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420556306 NA 7.49E-08 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420556306 NA 8.27E-07 mr1906 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420556306 NA 2.82E-06 mr1906 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420556306 NA 7.96E-06 mr1960 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420556306 NA 7.47E-08 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251