Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0420455986:

Variant ID: vg0420455986 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 20455986
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.11, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


TGAAGCGAGAATGTGGATGATCTTGCGCCATATTAGTTCATATGCATGTAGGTGCATTTGGTGGGCTTGTCTAGCCAAGTGTGGTGAGTATTCTCAAGTC[C/T]
TAAACAAAGAGAGATGTGGGCAAATCCTATAGGTTTGGGTAGCCTCATGTGGTTATGTCCGGTGGAGTATCCTTTGGAGTGTGAGCCCTTTTTCCCTGAG

Reverse complement sequence

CTCAGGGAAAAAGGGCTCACACTCCAAAGGATACTCCACCGGACATAACCACATGAGGCTACCCAAACCTATAGGATTTGCCCACATCTCTCTTTGTTTA[G/A]
GACTTGAGAATACTCACCACACTTGGCTAGACAAGCCCACCAAATGCACCTACATGCATATGAACTAATATGGCGCAAGATCATCCACATTCTCGCTTCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.00% 45.90% 0.08% 0.00% NA
All Indica  2759 91.30% 8.70% 0.07% 0.00% NA
All Japonica  1512 0.50% 99.50% 0.00% 0.00% NA
Aus  269 1.90% 98.10% 0.00% 0.00% NA
Indica I  595 99.00% 1.00% 0.00% 0.00% NA
Indica II  465 90.30% 9.70% 0.00% 0.00% NA
Indica III  913 91.00% 9.00% 0.00% 0.00% NA
Indica Intermediate  786 86.30% 13.50% 0.25% 0.00% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 99.20% 0.00% 0.00% NA
Japonica Intermediate  241 0.00% 100.00% 0.00% 0.00% NA
VI/Aromatic  96 0.00% 100.00% 0.00% 0.00% NA
Intermediate  90 24.40% 73.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0420455986 C -> T LOC_Os04g33780.1 upstream_gene_variant ; 1935.0bp to feature; MODIFIER silent_mutation Average:42.42; most accessible tissue: Minghui63 flag leaf, score: 56.489 N N N N
vg0420455986 C -> T LOC_Os04g33780.2 upstream_gene_variant ; 1937.0bp to feature; MODIFIER silent_mutation Average:42.42; most accessible tissue: Minghui63 flag leaf, score: 56.489 N N N N
vg0420455986 C -> T LOC_Os04g33770.1 downstream_gene_variant ; 4831.0bp to feature; MODIFIER silent_mutation Average:42.42; most accessible tissue: Minghui63 flag leaf, score: 56.489 N N N N
vg0420455986 C -> T LOC_Os04g33770-LOC_Os04g33780 intergenic_region ; MODIFIER silent_mutation Average:42.42; most accessible tissue: Minghui63 flag leaf, score: 56.489 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0420455986 NA 1.94E-16 mr1147 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 4.48E-12 mr1169 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 1.32E-19 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 1.40E-25 mr1181 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 2.89E-31 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 2.26E-11 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 2.07E-24 mr1264 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 4.41E-10 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 6.67E-07 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 5.02E-16 mr1362 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 1.25E-27 mr1426 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 1.86E-41 mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 1.84E-24 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 2.64E-25 mr1551 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 1.26E-18 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 2.53E-19 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 8.67E-16 mr1655 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 1.42E-07 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 2.72E-60 mr1671 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 2.79E-17 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 3.27E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 2.70E-07 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 2.80E-44 mr1721 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 2.03E-34 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 2.54E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 1.07E-06 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 1.29E-09 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 1.23E-07 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 5.59E-18 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 1.57E-12 mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 5.85E-15 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 1.60E-07 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 4.95E-63 mr1970 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 5.41E-31 mr1037_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 5.54E-41 mr1208_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 1.14E-44 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 6.25E-20 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 1.03E-32 mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 3.34E-77 mr1671_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 7.71E-22 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 1.90E-49 mr1721_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 1.64E-41 mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 7.11E-10 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 9.90E-46 mr1793_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 4.64E-16 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 7.22E-33 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420455986 NA 2.25E-29 mr1932_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251