\
| Variant ID: vg0420371360 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr04 | Position: 20371360 |
| Reference Allele: CCCTT | Alternative Allele: C,TCCTT |
| Primary Allele: CCCTT | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GCAACCTCCTAGAAAAGGAGAAAGTCGCTGCGCCAAGAAAAGGAAAACGATGCCTGAGTCGGAGATTTGGCCTTGGAGATAAACCTGCAAATCACAGTGA[CCCTT/C,TCCTT]
ATTGAATAGCCCGTGGCACTATAGATCGCAGTCTGTGGCGTGCAACTGGATGAATTTGAACCGGACCAAATCACATGGAAGTTCATAACCCACGAGCAGT
ACTGCTCGTGGGTTATGAACTTCCATGTGATTTGGTCCGGTTCAAATTCATCCAGTTGCACGCCACAGACTGCGATCTATAGTGCCACGGGCTATTCAAT[AAGGG/G,AAGGA]
TCACTGTGATTTGCAGGTTTATCTCCAAGGCCAAATCTCCGACTCAGGCATCGTTTTCCTTTTCTTGGCGCAGCGACTTTCTCCTTTTCTAGGAGGTTGC
| Populations | Population Size | Frequency of CCCTT(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.60% | 35.30% | 0.23% | 0.30% | TCCTT: 8.55% |
| All Indica | 2759 | 35.20% | 59.00% | 0.29% | 0.29% | TCCTT: 5.22% |
| All Japonica | 1512 | 99.30% | 0.40% | 0.07% | 0.13% | TCCTT: 0.13% |
| Aus | 269 | 10.00% | 4.50% | 0.37% | 0.00% | TCCTT: 85.13% |
| Indica I | 595 | 7.10% | 92.60% | 0.34% | 0.00% | NA |
| Indica II | 465 | 35.30% | 60.00% | 0.00% | 0.86% | TCCTT: 3.87% |
| Indica III | 913 | 51.80% | 41.90% | 0.55% | 0.00% | TCCTT: 5.70% |
| Indica Intermediate | 786 | 37.20% | 52.80% | 0.13% | 0.51% | TCCTT: 9.41% |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 0.60% | 0.00% | 0.20% | TCCTT: 0.20% |
| Japonica Intermediate | 241 | 98.80% | 0.00% | 0.41% | 0.41% | TCCTT: 0.41% |
| VI/Aromatic | 96 | 70.80% | 1.00% | 0.00% | 0.00% | TCCTT: 28.12% |
| Intermediate | 90 | 68.90% | 23.30% | 1.11% | 4.44% | TCCTT: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0420371360 | CCCTT -> TCCTT | LOC_Os04g33640.1 | upstream_gene_variant ; 1553.0bp to feature; MODIFIER | silent_mutation | Average:71.033; most accessible tissue: Zhenshan97 flag leaf, score: 88.111 | N | N | N | N |
| vg0420371360 | CCCTT -> TCCTT | LOC_Os04g33640.2 | upstream_gene_variant ; 1785.0bp to feature; MODIFIER | silent_mutation | Average:71.033; most accessible tissue: Zhenshan97 flag leaf, score: 88.111 | N | N | N | N |
| vg0420371360 | CCCTT -> TCCTT | LOC_Os04g33630.1 | downstream_gene_variant ; 2131.0bp to feature; MODIFIER | silent_mutation | Average:71.033; most accessible tissue: Zhenshan97 flag leaf, score: 88.111 | N | N | N | N |
| vg0420371360 | CCCTT -> TCCTT | LOC_Os04g33630-LOC_Os04g33640 | intergenic_region ; MODIFIER | silent_mutation | Average:71.033; most accessible tissue: Zhenshan97 flag leaf, score: 88.111 | N | N | N | N |
| vg0420371360 | CCCTT -> DEL | N | N | silent_mutation | Average:71.033; most accessible tissue: Zhenshan97 flag leaf, score: 88.111 | N | N | N | N |
| vg0420371360 | CCCTT -> C | LOC_Os04g33640.1 | upstream_gene_variant ; 1552.0bp to feature; MODIFIER | silent_mutation | Average:71.033; most accessible tissue: Zhenshan97 flag leaf, score: 88.111 | N | N | N | N |
| vg0420371360 | CCCTT -> C | LOC_Os04g33640.2 | upstream_gene_variant ; 1784.0bp to feature; MODIFIER | silent_mutation | Average:71.033; most accessible tissue: Zhenshan97 flag leaf, score: 88.111 | N | N | N | N |
| vg0420371360 | CCCTT -> C | LOC_Os04g33630.1 | downstream_gene_variant ; 2132.0bp to feature; MODIFIER | silent_mutation | Average:71.033; most accessible tissue: Zhenshan97 flag leaf, score: 88.111 | N | N | N | N |
| vg0420371360 | CCCTT -> C | LOC_Os04g33630-LOC_Os04g33640 | intergenic_region ; MODIFIER | silent_mutation | Average:71.033; most accessible tissue: Zhenshan97 flag leaf, score: 88.111 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0420371360 | NA | 3.33E-14 | mr1166 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420371360 | NA | 2.72E-07 | mr1320 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420371360 | NA | 1.57E-06 | mr1415 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420371360 | NA | 7.52E-07 | mr1438 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420371360 | NA | 5.60E-07 | mr1545 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420371360 | NA | 1.57E-06 | mr1567 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420371360 | NA | 2.96E-11 | mr1649 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420371360 | 4.47E-06 | NA | mr1928 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |