\
| Variant ID: vg0420368455 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 20368455 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATTAGTATGTAATTTTCGAATTTACATATGTAATTTTAGTACTTACATATGTAATTTTGAGACTTACATTGTAAATACACTAAAATTACATATGTAATTA[G/A]
GGACTTACAATGTAAATACATGTCGACTATTTTTTTTGATGGAAAATATGGCGCCATAAATATAGCATCTCCTCTCTTGCTTCTGATCACCATTATTTTT
AAAAATAATGGTGATCAGAAGCAAGAGAGGAGATGCTATATTTATGGCGCCATATTTTCCATCAAAAAAAATAGTCGACATGTATTTACATTGTAAGTCC[C/T]
TAATTACATATGTAATTTTAGTGTATTTACAATGTAAGTCTCAAAATTACATATGTAAGTACTAAAATTACATATGTAAATTCGAAAATTACATACTAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.60% | 17.10% | 0.17% | 0.11% | NA |
| All Indica | 2759 | 99.00% | 0.80% | 0.07% | 0.07% | NA |
| All Japonica | 1512 | 53.80% | 45.80% | 0.33% | 0.07% | NA |
| Aus | 269 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 0.60% | 0.22% | 0.22% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.70% | 2.00% | 0.13% | 0.13% | NA |
| Temperate Japonica | 767 | 79.50% | 20.10% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 33.70% | 66.10% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 14.10% | 85.10% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 33.30% | 66.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 28.90% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0420368455 | G -> DEL | N | N | silent_mutation | Average:81.265; most accessible tissue: Zhenshan97 flag leaf, score: 90.467 | N | N | N | N |
| vg0420368455 | G -> A | LOC_Os04g33620.1 | upstream_gene_variant ; 3701.0bp to feature; MODIFIER | silent_mutation | Average:81.265; most accessible tissue: Zhenshan97 flag leaf, score: 90.467 | N | N | N | N |
| vg0420368455 | G -> A | LOC_Os04g33640.1 | upstream_gene_variant ; 4458.0bp to feature; MODIFIER | silent_mutation | Average:81.265; most accessible tissue: Zhenshan97 flag leaf, score: 90.467 | N | N | N | N |
| vg0420368455 | G -> A | LOC_Os04g33640.2 | upstream_gene_variant ; 4690.0bp to feature; MODIFIER | silent_mutation | Average:81.265; most accessible tissue: Zhenshan97 flag leaf, score: 90.467 | N | N | N | N |
| vg0420368455 | G -> A | LOC_Os04g33630.1 | intron_variant ; MODIFIER | silent_mutation | Average:81.265; most accessible tissue: Zhenshan97 flag leaf, score: 90.467 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0420368455 | NA | 2.53E-06 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420368455 | NA | 2.94E-13 | mr1330 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420368455 | NA | 1.72E-10 | mr1332 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420368455 | 3.01E-06 | NA | mr1404 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420368455 | NA | 9.12E-08 | mr1404 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420368455 | NA | 3.06E-13 | mr1521 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420368455 | NA | 1.65E-06 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420368455 | 1.82E-06 | NA | mr1203_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420368455 | NA | 4.91E-06 | mr1282_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420368455 | NA | 7.38E-06 | mr1404_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |