\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420368455:

Variant ID: vg0420368455 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 20368455
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTAGTATGTAATTTTCGAATTTACATATGTAATTTTAGTACTTACATATGTAATTTTGAGACTTACATTGTAAATACACTAAAATTACATATGTAATTA[G/A]
GGACTTACAATGTAAATACATGTCGACTATTTTTTTTGATGGAAAATATGGCGCCATAAATATAGCATCTCCTCTCTTGCTTCTGATCACCATTATTTTT

Reverse complement sequence

AAAAATAATGGTGATCAGAAGCAAGAGAGGAGATGCTATATTTATGGCGCCATATTTTCCATCAAAAAAAATAGTCGACATGTATTTACATTGTAAGTCC[C/T]
TAATTACATATGTAATTTTAGTGTATTTACAATGTAAGTCTCAAAATTACATATGTAAGTACTAAAATTACATATGTAAATTCGAAAATTACATACTAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.60% 17.10% 0.17% 0.11% NA
All Indica  2759 99.00% 0.80% 0.07% 0.07% NA
All Japonica  1512 53.80% 45.80% 0.33% 0.07% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 98.90% 0.60% 0.22% 0.22% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 97.70% 2.00% 0.13% 0.13% NA
Temperate Japonica  767 79.50% 20.10% 0.39% 0.00% NA
Tropical Japonica  504 33.70% 66.10% 0.00% 0.20% NA
Japonica Intermediate  241 14.10% 85.10% 0.83% 0.00% NA
VI/Aromatic  96 33.30% 66.70% 0.00% 0.00% NA
Intermediate  90 67.80% 28.90% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0420368455 G -> DEL N N silent_mutation Average:81.265; most accessible tissue: Zhenshan97 flag leaf, score: 90.467 N N N N
vg0420368455 G -> A LOC_Os04g33620.1 upstream_gene_variant ; 3701.0bp to feature; MODIFIER silent_mutation Average:81.265; most accessible tissue: Zhenshan97 flag leaf, score: 90.467 N N N N
vg0420368455 G -> A LOC_Os04g33640.1 upstream_gene_variant ; 4458.0bp to feature; MODIFIER silent_mutation Average:81.265; most accessible tissue: Zhenshan97 flag leaf, score: 90.467 N N N N
vg0420368455 G -> A LOC_Os04g33640.2 upstream_gene_variant ; 4690.0bp to feature; MODIFIER silent_mutation Average:81.265; most accessible tissue: Zhenshan97 flag leaf, score: 90.467 N N N N
vg0420368455 G -> A LOC_Os04g33630.1 intron_variant ; MODIFIER silent_mutation Average:81.265; most accessible tissue: Zhenshan97 flag leaf, score: 90.467 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0420368455 NA 2.53E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420368455 NA 2.94E-13 mr1330 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420368455 NA 1.72E-10 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420368455 3.01E-06 NA mr1404 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420368455 NA 9.12E-08 mr1404 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420368455 NA 3.06E-13 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420368455 NA 1.65E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420368455 1.82E-06 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420368455 NA 4.91E-06 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420368455 NA 7.38E-06 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251