\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420332785:

Variant ID: vg0420332785 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 20332785
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


GGCTTTTTTATATACTGGCAAATATTCGTTGTCGTATTCGTTCCGTCTCGTATTCACTCTGTATCTGTATTCGATAATATTCAATTTCATTTCCGTATCC[A/G]
GGTTTTCGATTCTGATTCTGATTCCGATTCCAAAAAAATAAAAACGAATATGATAAAGCTAGTTTCCATCTGTTTTTTATCCGTTTTCATCCCTACTACT

Reverse complement sequence

AGTAGTAGGGATGAAAACGGATAAAAAACAGATGGAAACTAGCTTTATCATATTCGTTTTTATTTTTTTGGAATCGGAATCAGAATCAGAATCGAAAACC[T/C]
GGATACGGAAATGAAATTGAATATTATCGAATACAGATACAGAGTGAATACGAGACGGAACGAATACGACAACGAATATTTGCCAGTATATAAAAAAGCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.20% 30.30% 0.49% 0.08% NA
All Indica  2759 91.90% 7.80% 0.29% 0.04% NA
All Japonica  1512 41.40% 58.00% 0.46% 0.13% NA
Aus  269 23.00% 76.60% 0.37% 0.00% NA
Indica I  595 99.30% 0.30% 0.34% 0.00% NA
Indica II  465 91.40% 8.00% 0.65% 0.00% NA
Indica III  913 91.20% 8.70% 0.11% 0.00% NA
Indica Intermediate  786 87.40% 12.20% 0.25% 0.13% NA
Temperate Japonica  767 77.70% 22.20% 0.13% 0.00% NA
Tropical Japonica  504 1.60% 97.60% 0.60% 0.20% NA
Japonica Intermediate  241 9.10% 89.20% 1.24% 0.41% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 46.70% 44.40% 7.78% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0420332785 A -> DEL N N silent_mutation Average:49.607; most accessible tissue: Zhenshan97 panicle, score: 82.888 N N N N
vg0420332785 A -> G LOC_Os04g33580.1 downstream_gene_variant ; 4381.0bp to feature; MODIFIER silent_mutation Average:49.607; most accessible tissue: Zhenshan97 panicle, score: 82.888 N N N N
vg0420332785 A -> G LOC_Os04g33580-LOC_Os04g33590 intergenic_region ; MODIFIER silent_mutation Average:49.607; most accessible tissue: Zhenshan97 panicle, score: 82.888 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0420332785 NA 4.70E-13 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0420332785 NA 3.96E-13 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0420332785 NA 2.93E-06 mr1295 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420332785 NA 6.19E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420332785 NA 9.43E-09 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420332785 NA 1.01E-13 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420332785 NA 1.53E-08 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420332785 NA 2.61E-07 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420332785 NA 6.39E-08 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420332785 NA 3.95E-21 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420332785 NA 1.49E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420332785 NA 1.50E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420332785 NA 2.37E-23 mr1825 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420332785 NA 3.11E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420332785 NA 1.46E-06 mr1045_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420332785 NA 8.53E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420332785 NA 2.30E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420332785 NA 3.92E-06 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420332785 NA 7.38E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420332785 NA 4.02E-07 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420332785 NA 8.11E-12 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420332785 NA 2.64E-07 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420332785 NA 6.97E-08 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420332785 NA 4.18E-08 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420332785 NA 3.33E-32 mr1580_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420332785 NA 2.85E-10 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420332785 NA 1.95E-06 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420332785 NA 6.53E-07 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420332785 NA 9.80E-10 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420332785 NA 2.68E-30 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420332785 NA 1.47E-09 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420332785 NA 5.90E-07 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420332785 NA 4.43E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251