\
| Variant ID: vg0420332785 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 20332785 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 218. )
GGCTTTTTTATATACTGGCAAATATTCGTTGTCGTATTCGTTCCGTCTCGTATTCACTCTGTATCTGTATTCGATAATATTCAATTTCATTTCCGTATCC[A/G]
GGTTTTCGATTCTGATTCTGATTCCGATTCCAAAAAAATAAAAACGAATATGATAAAGCTAGTTTCCATCTGTTTTTTATCCGTTTTCATCCCTACTACT
AGTAGTAGGGATGAAAACGGATAAAAAACAGATGGAAACTAGCTTTATCATATTCGTTTTTATTTTTTTGGAATCGGAATCAGAATCAGAATCGAAAACC[T/C]
GGATACGGAAATGAAATTGAATATTATCGAATACAGATACAGAGTGAATACGAGACGGAACGAATACGACAACGAATATTTGCCAGTATATAAAAAAGCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.20% | 30.30% | 0.49% | 0.08% | NA |
| All Indica | 2759 | 91.90% | 7.80% | 0.29% | 0.04% | NA |
| All Japonica | 1512 | 41.40% | 58.00% | 0.46% | 0.13% | NA |
| Aus | 269 | 23.00% | 76.60% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.30% | 0.34% | 0.00% | NA |
| Indica II | 465 | 91.40% | 8.00% | 0.65% | 0.00% | NA |
| Indica III | 913 | 91.20% | 8.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 87.40% | 12.20% | 0.25% | 0.13% | NA |
| Temperate Japonica | 767 | 77.70% | 22.20% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 1.60% | 97.60% | 0.60% | 0.20% | NA |
| Japonica Intermediate | 241 | 9.10% | 89.20% | 1.24% | 0.41% | NA |
| VI/Aromatic | 96 | 3.10% | 96.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 46.70% | 44.40% | 7.78% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0420332785 | A -> DEL | N | N | silent_mutation | Average:49.607; most accessible tissue: Zhenshan97 panicle, score: 82.888 | N | N | N | N |
| vg0420332785 | A -> G | LOC_Os04g33580.1 | downstream_gene_variant ; 4381.0bp to feature; MODIFIER | silent_mutation | Average:49.607; most accessible tissue: Zhenshan97 panicle, score: 82.888 | N | N | N | N |
| vg0420332785 | A -> G | LOC_Os04g33580-LOC_Os04g33590 | intergenic_region ; MODIFIER | silent_mutation | Average:49.607; most accessible tissue: Zhenshan97 panicle, score: 82.888 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0420332785 | NA | 4.70E-13 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0420332785 | NA | 3.96E-13 | Spikelet_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0420332785 | NA | 2.93E-06 | mr1295 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420332785 | NA | 6.19E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420332785 | NA | 9.43E-09 | mr1521 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420332785 | NA | 1.01E-13 | mr1531 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420332785 | NA | 1.53E-08 | mr1549 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420332785 | NA | 2.61E-07 | mr1559 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420332785 | NA | 6.39E-08 | mr1570 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420332785 | NA | 3.95E-21 | mr1580 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420332785 | NA | 1.49E-06 | mr1729 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420332785 | NA | 1.50E-08 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420332785 | NA | 2.37E-23 | mr1825 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420332785 | NA | 3.11E-06 | mr1844 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420332785 | NA | 1.46E-06 | mr1045_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420332785 | NA | 8.53E-07 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420332785 | NA | 2.30E-07 | mr1229_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420332785 | NA | 3.92E-06 | mr1295_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420332785 | NA | 7.38E-06 | mr1346_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420332785 | NA | 4.02E-07 | mr1404_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420332785 | NA | 8.11E-12 | mr1486_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420332785 | NA | 2.64E-07 | mr1502_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420332785 | NA | 6.97E-08 | mr1521_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420332785 | NA | 4.18E-08 | mr1570_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420332785 | NA | 3.33E-32 | mr1580_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420332785 | NA | 2.85E-10 | mr1680_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420332785 | NA | 1.95E-06 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420332785 | NA | 6.53E-07 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420332785 | NA | 9.80E-10 | mr1805_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420332785 | NA | 2.68E-30 | mr1825_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420332785 | NA | 1.47E-09 | mr1825_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420332785 | NA | 5.90E-07 | mr1865_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420332785 | NA | 4.43E-08 | mr1880_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |