Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0420291464:

Variant ID: vg0420291464 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 20291464
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.62, A: 0.38, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


GTCACCGACTACCCCAGCTGGACTCGCTAAAGCGCGTAGCGGAGTAAGCGAGGATACGTTACGTTGCGGACAAGAAGAGAGAGAGAGAGGTGGCGCTGAC[A/G]
TGTAGGCCCCATATGCTGACTCAGTCGGTTATACCTATCAACGAGCCATGTCAGCGAAAATCACTCTCAAAACCATCGAGGTAGTTAAACTACATCAGTT

Reverse complement sequence

AACTGATGTAGTTTAACTACCTCGATGGTTTTGAGAGTGATTTTCGCTGACATGGCTCGTTGATAGGTATAACCGACTGAGTCAGCATATGGGGCCTACA[T/C]
GTCAGCGCCACCTCTCTCTCTCTCTTCTTGTCCGCAACGTAACGTATCCTCGCTTACTCCGCTACGCGCTTTAGCGAGTCCAGCTGGGGTAGTCGGTGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.50% 34.90% 1.16% 0.44% NA
All Indica  2759 95.60% 2.30% 1.41% 0.72% NA
All Japonica  1512 4.70% 95.00% 0.26% 0.00% NA
Aus  269 81.80% 15.20% 2.60% 0.37% NA
Indica I  595 96.10% 0.50% 2.86% 0.50% NA
Indica II  465 93.50% 4.70% 1.51% 0.22% NA
Indica III  913 97.60% 0.90% 0.44% 1.10% NA
Indica Intermediate  786 94.00% 3.80% 1.40% 0.76% NA
Temperate Japonica  767 1.80% 98.20% 0.00% 0.00% NA
Tropical Japonica  504 7.50% 92.30% 0.20% 0.00% NA
Japonica Intermediate  241 7.90% 90.90% 1.24% 0.00% NA
VI/Aromatic  96 38.50% 61.50% 0.00% 0.00% NA
Intermediate  90 41.10% 53.30% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0420291464 A -> DEL N N silent_mutation Average:81.269; most accessible tissue: Callus, score: 93.634 N N N N
vg0420291464 A -> G LOC_Os04g33540.1 downstream_gene_variant ; 4493.0bp to feature; MODIFIER silent_mutation Average:81.269; most accessible tissue: Callus, score: 93.634 N N N N
vg0420291464 A -> G LOC_Os04g33550.1 downstream_gene_variant ; 71.0bp to feature; MODIFIER silent_mutation Average:81.269; most accessible tissue: Callus, score: 93.634 N N N N
vg0420291464 A -> G LOC_Os04g33550-LOC_Os04g33560 intergenic_region ; MODIFIER silent_mutation Average:81.269; most accessible tissue: Callus, score: 93.634 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0420291464 A G 0.35 0.25 0.14 0.15 0.3 0.29

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0420291464 NA 6.46E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420291464 4.20E-07 3.79E-27 mr1698 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420291464 NA 1.13E-06 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420291464 NA 2.59E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420291464 NA 4.92E-09 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420291464 NA 1.46E-10 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420291464 NA 4.70E-10 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420291464 NA 1.03E-36 mr1689_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420291464 NA 1.40E-23 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420291464 NA 1.28E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420291464 NA 2.12E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420291464 NA 6.42E-10 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251