\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420244177:

Variant ID: vg0420244177 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 20244177
Reference Allele: TAlternative Allele: C,A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTTTAACAAAATGAACTAAAGAGATGAATATGGGTTTATGCTGCTCTACAACTTCACTCCAGACTCAACTCTTATAGTTAAATTTAGAAGTTAGAGTTA[T/C,A]
AAGAAAGAGGTCCAGAGTAGCTACTCCTTTTTCACATGACTAGTGATAATGATAATAACGGATCGCCCCTGGTTGCATCATGGAGGTCATGTGTGTCACG

Reverse complement sequence

CGTGACACACATGACCTCCATGATGCAACCAGGGGCGATCCGTTATTATCATTATCACTAGTCATGTGAAAAAGGAGTAGCTACTCTGGACCTCTTTCTT[A/G,T]
TAACTCTAACTTCTAAATTTAACTATAAGAGTTGAGTCTGGAGTGAAGTTGTAGAGCAGCATAAACCCATATTCATCTCTTTAGTTCATTTTGTTAAAGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.40% 39.90% 0.08% 0.34% C: 10.18%
All Indica  2759 81.50% 6.70% 0.07% 0.29% C: 11.49%
All Japonica  1512 0.40% 99.30% 0.00% 0.20% C: 0.07%
Aus  269 21.60% 26.80% 0.37% 0.00% C: 51.30%
Indica I  595 98.00% 1.20% 0.00% 0.34% C: 0.50%
Indica II  465 78.90% 9.20% 0.00% 0.65% C: 11.18%
Indica III  913 74.90% 7.10% 0.11% 0.00% C: 17.85%
Indica Intermediate  786 78.10% 8.80% 0.13% 0.38% C: 12.60%
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 0.60% 99.00% 0.00% 0.20% C: 0.20%
Japonica Intermediate  241 0.00% 99.20% 0.00% 0.83% NA
VI/Aromatic  96 0.00% 76.00% 0.00% 0.00% C: 23.96%
Intermediate  90 27.80% 63.30% 1.11% 5.56% C: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0420244177 T -> C LOC_Os04g33460.1 upstream_gene_variant ; 717.0bp to feature; MODIFIER silent_mutation Average:96.251; most accessible tissue: Minghui63 flower, score: 99.194 N N N N
vg0420244177 T -> C LOC_Os04g33470.1 downstream_gene_variant ; 1044.0bp to feature; MODIFIER silent_mutation Average:96.251; most accessible tissue: Minghui63 flower, score: 99.194 N N N N
vg0420244177 T -> C LOC_Os04g33470.2 downstream_gene_variant ; 1040.0bp to feature; MODIFIER silent_mutation Average:96.251; most accessible tissue: Minghui63 flower, score: 99.194 N N N N
vg0420244177 T -> C LOC_Os04g33460-LOC_Os04g33470 intergenic_region ; MODIFIER silent_mutation Average:96.251; most accessible tissue: Minghui63 flower, score: 99.194 N N N N
vg0420244177 T -> DEL N N silent_mutation Average:96.251; most accessible tissue: Minghui63 flower, score: 99.194 N N N N
vg0420244177 T -> A LOC_Os04g33460.1 upstream_gene_variant ; 717.0bp to feature; MODIFIER silent_mutation Average:96.251; most accessible tissue: Minghui63 flower, score: 99.194 N N N N
vg0420244177 T -> A LOC_Os04g33470.1 downstream_gene_variant ; 1044.0bp to feature; MODIFIER silent_mutation Average:96.251; most accessible tissue: Minghui63 flower, score: 99.194 N N N N
vg0420244177 T -> A LOC_Os04g33470.2 downstream_gene_variant ; 1040.0bp to feature; MODIFIER silent_mutation Average:96.251; most accessible tissue: Minghui63 flower, score: 99.194 N N N N
vg0420244177 T -> A LOC_Os04g33460-LOC_Os04g33470 intergenic_region ; MODIFIER silent_mutation Average:96.251; most accessible tissue: Minghui63 flower, score: 99.194 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0420244177 T A 0.0 0.0 0.06 0.01 0.03 0.04
vg0420244177 T C -0.04 -0.06 -0.06 -0.02 -0.04 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0420244177 NA 9.31E-76 mr1100 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420244177 NA 3.24E-17 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420244177 NA 2.82E-67 mr1619 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420244177 NA 1.90E-27 mr1723 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420244177 NA 2.74E-55 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420244177 NA 1.72E-59 mr1962 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420244177 NA 1.87E-13 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420244177 NA 5.81E-16 mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420244177 NA 2.22E-99 mr1100_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420244177 NA 4.35E-11 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420244177 NA 8.47E-28 mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420244177 NA 3.06E-17 mr1281_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420244177 NA 1.92E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420244177 NA 2.50E-20 mr1362_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420244177 NA 4.04E-12 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420244177 NA 7.92E-37 mr1541_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420244177 NA 6.53E-17 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420244177 NA 2.81E-24 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420244177 2.68E-06 1.75E-102 mr1619_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420244177 NA 5.91E-31 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420244177 NA 6.86E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420244177 NA 3.45E-17 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420244177 NA 2.14E-12 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420244177 NA 4.80E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420244177 NA 3.12E-14 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420244177 NA 1.94E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420244177 NA 2.23E-90 mr1795_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420244177 NA 8.52E-08 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420244177 NA 3.69E-33 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420244177 NA 7.05E-36 mr1888_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420244177 NA 1.13E-19 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251