\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420209955:

Variant ID: vg0420209955 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 20209955
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


TGGGTGAAGACCCTTTCTCCAGCAGTGTTGGTACCCACCAAGGGGCATTTACTCTTATAAAGCAAGACATGCAAGAAACCACATCATCAACAATTTTAAG[T/C]
CATTAGATCATATTAGTACAAAGATAATAACCGTTGGATCAAGAAGCTACTTATTCATCCAATTCAATCATTTATTAATTATCCATTCACCTCTCTTTAC

Reverse complement sequence

GTAAAGAGAGGTGAATGGATAATTAATAAATGATTGAATTGGATGAATAAGTAGCTTCTTGATCCAACGGTTATTATCTTTGTACTAATATGATCTAATG[A/G]
CTTAAAATTGTTGATGATGTGGTTTCTTGCATGTCTTGCTTTATAAGAGTAAATGCCCCTTGGTGGGTACCAACACTGCTGGAGAAAGGGTCTTCACCCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.20% 31.40% 0.30% 0.11% NA
All Indica  2759 94.70% 4.90% 0.29% 0.14% NA
All Japonica  1512 23.30% 76.70% 0.00% 0.07% NA
Aus  269 73.60% 26.00% 0.37% 0.00% NA
Indica I  595 97.30% 1.50% 0.67% 0.50% NA
Indica II  465 90.80% 8.60% 0.43% 0.22% NA
Indica III  913 97.30% 2.70% 0.00% 0.00% NA
Indica Intermediate  786 92.00% 7.80% 0.25% 0.00% NA
Temperate Japonica  767 25.00% 75.00% 0.00% 0.00% NA
Tropical Japonica  504 11.50% 88.50% 0.00% 0.00% NA
Japonica Intermediate  241 42.30% 57.30% 0.00% 0.41% NA
VI/Aromatic  96 32.30% 67.70% 0.00% 0.00% NA
Intermediate  90 35.60% 58.90% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0420209955 T -> C LOC_Os04g33370.1 upstream_gene_variant ; 1385.0bp to feature; MODIFIER silent_mutation Average:37.367; most accessible tissue: Minghui63 root, score: 49.234 N N N N
vg0420209955 T -> C LOC_Os04g33380.1 downstream_gene_variant ; 4984.0bp to feature; MODIFIER silent_mutation Average:37.367; most accessible tissue: Minghui63 root, score: 49.234 N N N N
vg0420209955 T -> C LOC_Os04g33360-LOC_Os04g33370 intergenic_region ; MODIFIER silent_mutation Average:37.367; most accessible tissue: Minghui63 root, score: 49.234 N N N N
vg0420209955 T -> DEL N N silent_mutation Average:37.367; most accessible tissue: Minghui63 root, score: 49.234 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0420209955 NA 4.01E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420209955 NA 5.71E-06 mr1807 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420209955 NA 1.56E-09 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420209955 NA 2.21E-08 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420209955 NA 3.98E-12 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420209955 NA 3.64E-09 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420209955 NA 1.25E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420209955 NA 4.84E-06 mr1702_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420209955 NA 7.08E-14 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420209955 NA 4.72E-09 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420209955 NA 1.98E-09 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420209955 NA 9.51E-10 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420209955 NA 3.93E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420209955 NA 1.66E-09 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420209955 NA 8.12E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420209955 NA 2.25E-09 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420209955 NA 3.97E-24 mr1916_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251