Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420209955:

Variant ID: vg0420209955 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 20209955
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

TGGGTGAAGACCCTTTCTCCAGCAGTGTTGGTACCCACCAAGGGGCATTTACTCTTATAAAGCAAGACATGCAAGAAACCACATCATCAACAATTTTAAG[T/C]
CATTAGATCATATTAGTACAAAGATAATAACCGTTGGATCAAGAAGCTACTTATTCATCCAATTCAATCATTTATTAATTATCCATTCACCTCTCTTTAC

Reverse complement sequence

GTAAAGAGAGGTGAATGGATAATTAATAAATGATTGAATTGGATGAATAAGTAGCTTCTTGATCCAACGGTTATTATCTTTGTACTAATATGATCTAATG[A/G]
CTTAAAATTGTTGATGATGTGGTTTCTTGCATGTCTTGCTTTATAAGAGTAAATGCCCCTTGGTGGGTACCAACACTGCTGGAGAAAGGGTCTTCACCCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.20%	31.40%	0.30%	0.11%	NA
All Indica	2759	94.70%	4.90%	0.29%	0.14%	NA
All Japonica	1512	23.30%	76.70%	0.00%	0.07%	NA
Aus	269	73.60%	26.00%	0.37%	0.00%	NA
Indica I	595	97.30%	1.50%	0.67%	0.50%	NA
Indica II	465	90.80%	8.60%	0.43%	0.22%	NA
Indica III	913	97.30%	2.70%	0.00%	0.00%	NA
Indica Intermediate	786	92.00%	7.80%	0.25%	0.00%	NA
Temperate Japonica	767	25.00%	75.00%	0.00%	0.00%	NA
Tropical Japonica	504	11.50%	88.50%	0.00%	0.00%	NA
Japonica Intermediate	241	42.30%	57.30%	0.00%	0.41%	NA
VI/Aromatic	96	32.30%	67.70%	0.00%	0.00%	NA
Intermediate	90	35.60%	58.90%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0420209955	T -> C	LOC_Os04g33370.1	upstream_gene_variant ; 1385.0bp to feature; MODIFIER	silent_mutation	Average:37.367; most accessible tissue: Minghui63 root, score: 49.234	N	N	N	N
vg0420209955	T -> C	LOC_Os04g33380.1	downstream_gene_variant ; 4984.0bp to feature; MODIFIER	silent_mutation	Average:37.367; most accessible tissue: Minghui63 root, score: 49.234	N	N	N	N
vg0420209955	T -> C	LOC_Os04g33360-LOC_Os04g33370	intergenic_region ; MODIFIER	silent_mutation	Average:37.367; most accessible tissue: Minghui63 root, score: 49.234	N	N	N	N
vg0420209955	T -> DEL	N	N	silent_mutation	Average:37.367; most accessible tissue: Minghui63 root, score: 49.234	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0420209955	NA	4.01E-08	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420209955	NA	5.71E-06	mr1807	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420209955	NA	1.56E-09	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420209955	NA	2.21E-08	mr1510_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420209955	NA	3.98E-12	mr1537_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420209955	NA	3.64E-09	mr1600_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420209955	NA	1.25E-08	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420209955	NA	4.84E-06	mr1702_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420209955	NA	7.08E-14	mr1713_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420209955	NA	4.72E-09	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420209955	NA	1.98E-09	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420209955	NA	9.51E-10	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420209955	NA	3.93E-06	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420209955	NA	1.66E-09	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420209955	NA	8.12E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420209955	NA	2.25E-09	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420209955	NA	3.97E-24	mr1916_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251