Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420200137:

Variant ID: vg0420200137 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 20200137
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.53, G: 0.47, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


CATTGCCTTATTTTTCTCTATAGACTATCTCCAGGTTAGTAGATAGCTTTGCTCTCTCTCTTTATTTAATCTCTTCAAAGTAGAAAAATATGCTGACATG[A/G]
ATCTCTTATAGAGAGCCTATAGATAACCATTGCGGGTGCCCTTATGAATTGGGTTTCTCTTTTCTTCTCAAGAGTTCCCTTTGGCTTCCCACCCCTCCTT

Reverse complement sequence

AAGGAGGGGTGGGAAGCCAAAGGGAACTCTTGAGAAGAAAAGAGAAACCCAATTCATAAGGGCACCCGCAATGGTTATCTATAGGCTCTCTATAAGAGAT[T/C]
CATGTCAGCATATTTTTCTACTTTGAAGAGATTAAATAAAGAGAGAGAGCAAAGCTATCTACTAACCTGGAGATAGTCTATAGAGAAAAATAAGGCAATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.40% 34.30% 0.13% 0.15% NA
All Indica  2759 95.00% 4.60% 0.18% 0.25% NA
All Japonica  1512 14.60% 85.40% 0.00% 0.00% NA
Aus  269 74.00% 26.00% 0.00% 0.00% NA
Indica I  595 97.60% 1.50% 0.50% 0.34% NA
Indica II  465 90.30% 8.80% 0.22% 0.65% NA
Indica III  913 97.40% 2.60% 0.00% 0.00% NA
Indica Intermediate  786 92.90% 6.70% 0.13% 0.25% NA
Temperate Japonica  767 14.50% 85.50% 0.00% 0.00% NA
Tropical Japonica  504 7.70% 92.30% 0.00% 0.00% NA
Japonica Intermediate  241 29.00% 71.00% 0.00% 0.00% NA
VI/Aromatic  96 22.90% 77.10% 0.00% 0.00% NA
Intermediate  90 34.40% 64.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0420200137 A -> DEL N N silent_mutation Average:85.718; most accessible tissue: Minghui63 panicle, score: 94.477 N N N N
vg0420200137 A -> G LOC_Os04g33360.1 5_prime_UTR_variant ; 400.0bp to feature; MODIFIER silent_mutation Average:85.718; most accessible tissue: Minghui63 panicle, score: 94.477 N N N N
vg0420200137 A -> G LOC_Os04g33350.1 downstream_gene_variant ; 3924.0bp to feature; MODIFIER silent_mutation Average:85.718; most accessible tissue: Minghui63 panicle, score: 94.477 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0420200137 A G 0.01 0.01 0.01 0.02 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0420200137 NA 8.80E-07 mr1807 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420200137 NA 1.36E-14 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420200137 NA 1.39E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420200137 NA 5.21E-07 mr1149_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420200137 NA 3.01E-10 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420200137 NA 1.65E-06 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420200137 NA 1.65E-08 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420200137 NA 2.80E-13 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420200137 NA 1.91E-17 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420200137 NA 1.19E-10 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420200137 NA 1.69E-09 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420200137 NA 9.48E-19 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420200137 NA 1.87E-09 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420200137 NA 1.33E-06 mr1702_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420200137 NA 6.16E-15 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420200137 NA 2.79E-09 mr1727_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420200137 NA 1.81E-09 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420200137 NA 3.36E-10 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420200137 NA 1.52E-12 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420200137 NA 1.78E-10 mr1783_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420200137 NA 7.46E-07 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420200137 NA 5.06E-06 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420200137 NA 4.59E-10 mr1804_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420200137 NA 1.12E-07 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420200137 NA 7.55E-07 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420200137 NA 7.51E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420200137 NA 2.79E-10 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420200137 NA 1.19E-24 mr1916_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420200137 NA 4.96E-14 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251