\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420198457:

Variant ID: vg0420198457 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 20198457
Reference Allele: TAlternative Allele: C,TTTTAC
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.51, C: 0.50, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAAAAATAAAAAAGATCAATCATCTAAAATTGACGTTATTAGATTTATAATTAAACAAACTATCATAATATGTAACTTTTTTTATTTAAAACATCTTA[T/C,TTTTAC]
TTTTATAAATATTGTTGATCAAAGTAGCATTTCGGAGACCGAGTTAGAATCCAAAAATGCTTATATTTTTGGGACGGATGGAGTAGGAAAATGGTAGTAA

Reverse complement sequence

TTACTACCATTTTCCTACTCCATCCGTCCCAAAAATATAAGCATTTTTGGATTCTAACTCGGTCTCCGAAATGCTACTTTGATCAACAATATTTATAAAA[A/G,GTAAAA]
TAAGATGTTTTAAATAAAAAAAGTTACATATTATGATAGTTTGTTTAATTATAAATCTAATAACGTCAATTTTAGATGATTGATCTTTTTTATTTTTTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.80% 34.10% 0.21% 0.23% TTTTAC: 0.66%
All Indica  2759 93.80% 4.60% 0.25% 0.33% TTTTAC: 1.05%
All Japonica  1512 14.70% 85.20% 0.13% 0.00% NA
Aus  269 74.00% 25.30% 0.00% 0.00% TTTTAC: 0.74%
Indica I  595 97.50% 1.70% 0.50% 0.34% NA
Indica II  465 90.30% 8.80% 0.00% 0.86% NA
Indica III  913 94.40% 2.60% 0.33% 0.00% TTTTAC: 2.63%
Indica Intermediate  786 92.20% 6.60% 0.13% 0.38% TTTTAC: 0.64%
Temperate Japonica  767 14.70% 85.30% 0.00% 0.00% NA
Tropical Japonica  504 7.70% 92.30% 0.00% 0.00% NA
Japonica Intermediate  241 29.00% 70.10% 0.83% 0.00% NA
VI/Aromatic  96 22.90% 77.10% 0.00% 0.00% NA
Intermediate  90 34.40% 62.20% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0420198457 T -> C LOC_Os04g33360.1 upstream_gene_variant ; 1615.0bp to feature; MODIFIER silent_mutation Average:39.802; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0420198457 T -> C LOC_Os04g33350.1 downstream_gene_variant ; 2244.0bp to feature; MODIFIER silent_mutation Average:39.802; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0420198457 T -> C LOC_Os04g33350-LOC_Os04g33360 intergenic_region ; MODIFIER silent_mutation Average:39.802; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0420198457 T -> DEL N N silent_mutation Average:39.802; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0420198457 T -> TTTTAC LOC_Os04g33360.1 upstream_gene_variant ; 1614.0bp to feature; MODIFIER silent_mutation Average:39.802; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0420198457 T -> TTTTAC LOC_Os04g33350.1 downstream_gene_variant ; 2245.0bp to feature; MODIFIER silent_mutation Average:39.802; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0420198457 T -> TTTTAC LOC_Os04g33350-LOC_Os04g33360 intergenic_region ; MODIFIER silent_mutation Average:39.802; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0420198457 NA 8.80E-07 mr1807 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457 NA 9.25E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457 NA 9.48E-15 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457 NA 5.03E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457 NA 5.21E-07 mr1149_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457 NA 7.71E-10 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457 NA 3.24E-09 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457 NA 1.65E-08 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457 NA 1.40E-13 mr1537_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457 NA 4.68E-17 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457 NA 1.32E-10 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457 NA 2.61E-09 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457 NA 5.26E-09 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457 NA 1.33E-06 mr1702_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457 NA 7.80E-15 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457 NA 7.87E-09 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457 NA 4.48E-09 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457 NA 7.10E-13 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457 NA 4.36E-10 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457 NA 1.51E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457 NA 5.06E-06 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457 NA 1.20E-09 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457 NA 2.44E-07 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457 NA 1.41E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457 NA 6.96E-10 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457 NA 1.37E-24 mr1916_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251