Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420198457:

Variant ID: vg0420198457 (JBrowse)	Variation Type: INDEL
Chromosome: chr04	Position: 20198457
Reference Allele: T	Alternative Allele: C,TTTTAC
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.51, C: 0.50, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:

AAAAAAAATAAAAAAGATCAATCATCTAAAATTGACGTTATTAGATTTATAATTAAACAAACTATCATAATATGTAACTTTTTTTATTTAAAACATCTTA[T/C,TTTTAC]
TTTTATAAATATTGTTGATCAAAGTAGCATTTCGGAGACCGAGTTAGAATCCAAAAATGCTTATATTTTTGGGACGGATGGAGTAGGAAAATGGTAGTAA

Reverse complement sequence

TTACTACCATTTTCCTACTCCATCCGTCCCAAAAATATAAGCATTTTTGGATTCTAACTCGGTCTCCGAAATGCTACTTTGATCAACAATATTTATAAAA[A/G,GTAAAA]
TAAGATGTTTTAAATAAAAAAAGTTACATATTATGATAGTTTGTTTAATTATAAATCTAATAACGTCAATTTTAGATGATTGATCTTTTTTATTTTTTTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.80%	34.10%	0.21%	0.23%	TTTTAC: 0.66%
All Indica	2759	93.80%	4.60%	0.25%	0.33%	TTTTAC: 1.05%
All Japonica	1512	14.70%	85.20%	0.13%	0.00%	NA
Aus	269	74.00%	25.30%	0.00%	0.00%	TTTTAC: 0.74%
Indica I	595	97.50%	1.70%	0.50%	0.34%	NA
Indica II	465	90.30%	8.80%	0.00%	0.86%	NA
Indica III	913	94.40%	2.60%	0.33%	0.00%	TTTTAC: 2.63%
Indica Intermediate	786	92.20%	6.60%	0.13%	0.38%	TTTTAC: 0.64%
Temperate Japonica	767	14.70%	85.30%	0.00%	0.00%	NA
Tropical Japonica	504	7.70%	92.30%	0.00%	0.00%	NA
Japonica Intermediate	241	29.00%	70.10%	0.83%	0.00%	NA
VI/Aromatic	96	22.90%	77.10%	0.00%	0.00%	NA
Intermediate	90	34.40%	62.20%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0420198457	T -> C	LOC_Os04g33360.1	upstream_gene_variant ; 1615.0bp to feature; MODIFIER	silent_mutation	Average:39.802; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0420198457	T -> C	LOC_Os04g33350.1	downstream_gene_variant ; 2244.0bp to feature; MODIFIER	silent_mutation	Average:39.802; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0420198457	T -> C	LOC_Os04g33350-LOC_Os04g33360	intergenic_region ; MODIFIER	silent_mutation	Average:39.802; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0420198457	T -> DEL	N	N	silent_mutation	Average:39.802; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0420198457	T -> TTTTAC	LOC_Os04g33360.1	upstream_gene_variant ; 1614.0bp to feature; MODIFIER	silent_mutation	Average:39.802; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0420198457	T -> TTTTAC	LOC_Os04g33350.1	downstream_gene_variant ; 2245.0bp to feature; MODIFIER	silent_mutation	Average:39.802; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0420198457	T -> TTTTAC	LOC_Os04g33350-LOC_Os04g33360	intergenic_region ; MODIFIER	silent_mutation	Average:39.802; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0420198457	NA	8.80E-07	mr1807	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457	NA	9.25E-12	mr1940	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457	NA	9.48E-15	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457	NA	5.03E-07	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457	NA	5.21E-07	mr1149_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457	NA	7.71E-10	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457	NA	3.24E-09	mr1398_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457	NA	1.65E-08	mr1510_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457	NA	1.40E-13	mr1537_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457	NA	4.68E-17	mr1592_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457	NA	1.32E-10	mr1595_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457	NA	2.61E-09	mr1600_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457	NA	5.26E-09	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457	NA	1.33E-06	mr1702_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457	NA	7.80E-15	mr1713_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457	NA	7.87E-09	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457	NA	4.48E-09	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457	NA	7.10E-13	mr1770_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457	NA	4.36E-10	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457	NA	1.51E-06	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457	NA	5.06E-06	mr1788_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457	NA	1.20E-09	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457	NA	2.44E-07	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457	NA	1.41E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457	NA	6.96E-10	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420198457	NA	1.37E-24	mr1916_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251