\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420192125:

Variant ID: vg0420192125 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 20192125
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.01, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAACGGAGGAATAGAAAAAAATGATAGGAATTAAAGTATAAAACAGAGGATTGCAAAACACAGGTAAAATATAGGAATGGTCGTTTGACTGGAGCGCA[A/G]
GAAAAACGCAGGAATCGGATGAGAGAGATAGACTCAAAGGAAATTTTTCAAGAGGTTAGAGCTCTTGCTAAATTTTCTTCAAAATCCACATGCAATGTAC

Reverse complement sequence

GTACATTGCATGTGGATTTTGAAGAAAATTTAGCAAGAGCTCTAACCTCTTGAAAAATTTCCTTTGAGTCTATCTCTCTCATCCGATTCCTGCGTTTTTC[T/C]
TGCGCTCCAGTCAAACGACCATTCCTATATTTTACCTGTGTTTTGCAATCCTCTGTTTTATACTTTAATTCCTATCATTTTTTTCTATTCCTCCGTTTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.10% 39.20% 1.16% 4.51% NA
All Indica  2759 85.50% 5.10% 1.78% 7.68% NA
All Japonica  1512 0.50% 99.50% 0.00% 0.00% NA
Aus  269 73.20% 25.70% 1.12% 0.00% NA
Indica I  595 94.10% 1.80% 2.02% 2.02% NA
Indica II  465 82.80% 9.20% 2.37% 5.59% NA
Indica III  913 85.40% 2.80% 0.55% 11.17% NA
Indica Intermediate  786 80.50% 7.60% 2.67% 9.16% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 99.00% 0.00% 0.00% NA
Japonica Intermediate  241 0.00% 100.00% 0.00% 0.00% NA
VI/Aromatic  96 22.90% 77.10% 0.00% 0.00% NA
Intermediate  90 24.40% 71.10% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0420192125 A -> DEL N N silent_mutation Average:78.232; most accessible tissue: Zhenshan97 flower, score: 96.097 N N N N
vg0420192125 A -> G LOC_Os04g33330.1 upstream_gene_variant ; 2723.0bp to feature; MODIFIER silent_mutation Average:78.232; most accessible tissue: Zhenshan97 flower, score: 96.097 N N N N
vg0420192125 A -> G LOC_Os04g33340.1 upstream_gene_variant ; 1137.0bp to feature; MODIFIER silent_mutation Average:78.232; most accessible tissue: Zhenshan97 flower, score: 96.097 N N N N
vg0420192125 A -> G LOC_Os04g33350.1 upstream_gene_variant ; 3233.0bp to feature; MODIFIER silent_mutation Average:78.232; most accessible tissue: Zhenshan97 flower, score: 96.097 N N N N
vg0420192125 A -> G LOC_Os04g33330.2 upstream_gene_variant ; 2722.0bp to feature; MODIFIER silent_mutation Average:78.232; most accessible tissue: Zhenshan97 flower, score: 96.097 N N N N
vg0420192125 A -> G LOC_Os04g33340-LOC_Os04g33350 intergenic_region ; MODIFIER silent_mutation Average:78.232; most accessible tissue: Zhenshan97 flower, score: 96.097 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0420192125 A G 0.0 0.0 0.0 0.01 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0420192125 NA 7.63E-17 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420192125 NA 2.97E-19 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420192125 1.28E-06 NA mr1247 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420192125 NA 7.55E-28 mr1723 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420192125 NA 3.63E-52 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420192125 NA 5.17E-54 mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420192125 NA 7.20E-24 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420192125 NA 3.11E-15 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420192125 NA 3.91E-24 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420192125 NA 1.02E-17 mr1281_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420192125 NA 4.97E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420192125 NA 9.51E-20 mr1362_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420192125 NA 1.39E-11 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420192125 NA 1.86E-16 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420192125 NA 6.50E-23 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420192125 NA 4.42E-30 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420192125 NA 5.65E-18 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420192125 NA 5.09E-13 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420192125 NA 1.24E-06 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420192125 NA 1.55E-13 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420192125 NA 5.69E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420192125 NA 2.88E-07 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420192125 NA 7.21E-32 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420192125 NA 4.02E-47 mr1861_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420192125 NA 5.44E-20 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251