\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420103716:

Variant ID: vg0420103716 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 20103716
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAATCCGTTCGAAACGAGGATATGGTATGGGCTTTTCGAAATCCGGGGGATACGGATGCGGATAGTATGAGATGGATGCGGATGCGGATGCGGATATGGT[G/A]
TCTCTAAAATCCGACATTATGTGATAAGCCGTTTGCCGGATAATCCGAGATTATCAACATATATAACCACTCTATCTATTCTATATAACATAAGTTGGTA

Reverse complement sequence

TACCAACTTATGTTATATAGAATAGATAGAGTGGTTATATATGTTGATAATCTCGGATTATCCGGCAAACGGCTTATCACATAATGTCGGATTTTAGAGA[C/T]
ACCATATCCGCATCCGCATCCGCATCCATCTCATACTATCCGCATCCGTATCCCCCGGATTTCGAAAAGCCCATACCATATCCTCGTTTCGAACGGATTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.60% 15.10% 1.71% 48.58% NA
All Indica  2759 6.30% 11.10% 2.65% 79.99% NA
All Japonica  1512 81.20% 18.20% 0.26% 0.33% NA
Aus  269 33.50% 41.30% 0.74% 24.54% NA
Indica I  595 4.90% 0.20% 1.85% 93.11% NA
Indica II  465 10.30% 1.70% 2.80% 85.16% NA
Indica III  913 3.80% 22.30% 2.96% 70.87% NA
Indica Intermediate  786 7.90% 11.70% 2.80% 77.61% NA
Temperate Japonica  767 79.50% 19.70% 0.52% 0.26% NA
Tropical Japonica  504 89.50% 9.90% 0.00% 0.60% NA
Japonica Intermediate  241 69.30% 30.70% 0.00% 0.00% NA
VI/Aromatic  96 83.30% 16.70% 0.00% 0.00% NA
Intermediate  90 68.90% 8.90% 2.22% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0420103716 G -> DEL N N silent_mutation Average:12.0; most accessible tissue: Callus, score: 75.809 N N N N
vg0420103716 G -> A LOC_Os04g33220.1 upstream_gene_variant ; 696.0bp to feature; MODIFIER silent_mutation Average:12.0; most accessible tissue: Callus, score: 75.809 N N N N
vg0420103716 G -> A LOC_Os04g33210.1 downstream_gene_variant ; 3987.0bp to feature; MODIFIER silent_mutation Average:12.0; most accessible tissue: Callus, score: 75.809 N N N N
vg0420103716 G -> A LOC_Os04g33230.1 downstream_gene_variant ; 1366.0bp to feature; MODIFIER silent_mutation Average:12.0; most accessible tissue: Callus, score: 75.809 N N N N
vg0420103716 G -> A LOC_Os04g33220-LOC_Os04g33230 intergenic_region ; MODIFIER silent_mutation Average:12.0; most accessible tissue: Callus, score: 75.809 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0420103716 NA 2.15E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420103716 NA 6.29E-06 mr1337_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420103716 NA 3.29E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420103716 NA 8.55E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420103716 NA 2.03E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420103716 NA 1.60E-06 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420103716 NA 1.42E-12 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420103716 NA 6.90E-07 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420103716 NA 2.15E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420103716 NA 2.17E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420103716 NA 2.97E-09 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420103716 NA 5.42E-08 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420103716 4.49E-06 NA mr1891_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420103716 NA 2.56E-07 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251