Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420103716:

Variant ID: vg0420103716 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 20103716
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAATCCGTTCGAAACGAGGATATGGTATGGGCTTTTCGAAATCCGGGGGATACGGATGCGGATAGTATGAGATGGATGCGGATGCGGATGCGGATATGGT[G/A]
TCTCTAAAATCCGACATTATGTGATAAGCCGTTTGCCGGATAATCCGAGATTATCAACATATATAACCACTCTATCTATTCTATATAACATAAGTTGGTA

Reverse complement sequence

TACCAACTTATGTTATATAGAATAGATAGAGTGGTTATATATGTTGATAATCTCGGATTATCCGGCAAACGGCTTATCACATAATGTCGGATTTTAGAGA[C/T]
ACCATATCCGCATCCGCATCCGCATCCATCTCATACTATCCGCATCCGTATCCCCCGGATTTCGAAAAGCCCATACCATATCCTCGTTTCGAACGGATTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.60%	15.10%	1.71%	48.58%	NA
All Indica	2759	6.30%	11.10%	2.65%	79.99%	NA
All Japonica	1512	81.20%	18.20%	0.26%	0.33%	NA
Aus	269	33.50%	41.30%	0.74%	24.54%	NA
Indica I	595	4.90%	0.20%	1.85%	93.11%	NA
Indica II	465	10.30%	1.70%	2.80%	85.16%	NA
Indica III	913	3.80%	22.30%	2.96%	70.87%	NA
Indica Intermediate	786	7.90%	11.70%	2.80%	77.61%	NA
Temperate Japonica	767	79.50%	19.70%	0.52%	0.26%	NA
Tropical Japonica	504	89.50%	9.90%	0.00%	0.60%	NA
Japonica Intermediate	241	69.30%	30.70%	0.00%	0.00%	NA
VI/Aromatic	96	83.30%	16.70%	0.00%	0.00%	NA
Intermediate	90	68.90%	8.90%	2.22%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0420103716	G -> DEL	N	N	silent_mutation	Average:12.0; most accessible tissue: Callus, score: 75.809	N	N	N	N
vg0420103716	G -> A	LOC_Os04g33220.1	upstream_gene_variant ; 696.0bp to feature; MODIFIER	silent_mutation	Average:12.0; most accessible tissue: Callus, score: 75.809	N	N	N	N
vg0420103716	G -> A	LOC_Os04g33210.1	downstream_gene_variant ; 3987.0bp to feature; MODIFIER	silent_mutation	Average:12.0; most accessible tissue: Callus, score: 75.809	N	N	N	N
vg0420103716	G -> A	LOC_Os04g33230.1	downstream_gene_variant ; 1366.0bp to feature; MODIFIER	silent_mutation	Average:12.0; most accessible tissue: Callus, score: 75.809	N	N	N	N
vg0420103716	G -> A	LOC_Os04g33220-LOC_Os04g33230	intergenic_region ; MODIFIER	silent_mutation	Average:12.0; most accessible tissue: Callus, score: 75.809	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0420103716	NA	2.15E-06	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420103716	NA	6.29E-06	mr1337_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420103716	NA	3.29E-07	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420103716	NA	8.55E-06	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420103716	NA	2.03E-06	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420103716	NA	1.60E-06	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420103716	NA	1.42E-12	mr1713_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420103716	NA	6.90E-07	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420103716	NA	2.15E-08	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420103716	NA	2.17E-06	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420103716	NA	2.97E-09	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420103716	NA	5.42E-08	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420103716	4.49E-06	NA	mr1891_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420103716	NA	2.56E-07	mr1982_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251