\
| Variant ID: vg0419990751 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 19990751 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 204. )
TTTGGGGAAAAAACATAGAAATTTGGAGGATTACAATCCTATAAAAAAATTTCCATTCAAGCCTTTTGAAACAAAAGGACTTAATCCTATCCTATCATTT[G/A]
AAATTCGTATGTAATGGATAATCCTATAGAGATTTTAAAGGAAATTTAGCAAAAACTTCAACCTCTTGGAAACTTTTCTTTGAGTCTATCCCTCTCATCC
GGATGAGAGGGATAGACTCAAAGAAAAGTTTCCAAGAGGTTGAAGTTTTTGCTAAATTTCCTTTAAAATCTCTATAGGATTATCCATTACATACGAATTT[C/T]
AAATGATAGGATAGGATTAAGTCCTTTTGTTTCAAAAGGCTTGAATGGAAATTTTTTTATAGGATTGTAATCCTCCAAATTTCTATGTTTTTTCCCCAAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.00% | 46.70% | 0.21% | 0.02% | NA |
| All Indica | 2759 | 75.70% | 24.00% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 19.00% | 80.80% | 0.13% | 0.07% | NA |
| Aus | 269 | 35.70% | 64.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.80% | 4.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 83.90% | 15.70% | 0.43% | 0.00% | NA |
| Indica III | 913 | 55.80% | 44.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 78.90% | 20.70% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 12.40% | 87.50% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 15.50% | 84.10% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 47.30% | 52.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 6.20% | 93.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 32.20% | 66.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0419990751 | G -> DEL | N | N | silent_mutation | Average:40.989; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0419990751 | G -> A | LOC_Os04g33030.1 | upstream_gene_variant ; 3666.0bp to feature; MODIFIER | silent_mutation | Average:40.989; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0419990751 | G -> A | LOC_Os04g33030.2 | upstream_gene_variant ; 3725.0bp to feature; MODIFIER | silent_mutation | Average:40.989; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0419990751 | G -> A | LOC_Os04g33020-LOC_Os04g33030 | intergenic_region ; MODIFIER | silent_mutation | Average:40.989; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0419990751 | NA | 7.90E-06 | mr1029 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419990751 | NA | 9.94E-06 | mr1734 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419990751 | NA | 1.78E-06 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419990751 | 4.28E-06 | NA | mr1693_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419990751 | NA | 1.24E-06 | mr1702_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419990751 | NA | 1.34E-06 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419990751 | NA | 9.38E-07 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419990751 | NA | 1.72E-08 | mr1804_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |