Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419990751:

Variant ID: vg0419990751 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 19990751
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:

TTTGGGGAAAAAACATAGAAATTTGGAGGATTACAATCCTATAAAAAAATTTCCATTCAAGCCTTTTGAAACAAAAGGACTTAATCCTATCCTATCATTT[G/A]
AAATTCGTATGTAATGGATAATCCTATAGAGATTTTAAAGGAAATTTAGCAAAAACTTCAACCTCTTGGAAACTTTTCTTTGAGTCTATCCCTCTCATCC

Reverse complement sequence

GGATGAGAGGGATAGACTCAAAGAAAAGTTTCCAAGAGGTTGAAGTTTTTGCTAAATTTCCTTTAAAATCTCTATAGGATTATCCATTACATACGAATTT[C/T]
AAATGATAGGATAGGATTAAGTCCTTTTGTTTCAAAAGGCTTGAATGGAAATTTTTTTATAGGATTGTAATCCTCCAAATTTCTATGTTTTTTCCCCAAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.00%	46.70%	0.21%	0.02%	NA
All Indica	2759	75.70%	24.00%	0.25%	0.00%	NA
All Japonica	1512	19.00%	80.80%	0.13%	0.07%	NA
Aus	269	35.70%	64.30%	0.00%	0.00%	NA
Indica I	595	95.80%	4.00%	0.17%	0.00%	NA
Indica II	465	83.90%	15.70%	0.43%	0.00%	NA
Indica III	913	55.80%	44.10%	0.11%	0.00%	NA
Indica Intermediate	786	78.90%	20.70%	0.38%	0.00%	NA
Temperate Japonica	767	12.40%	87.50%	0.13%	0.00%	NA
Tropical Japonica	504	15.50%	84.10%	0.20%	0.20%	NA
Japonica Intermediate	241	47.30%	52.70%	0.00%	0.00%	NA
VI/Aromatic	96	6.20%	93.80%	0.00%	0.00%	NA
Intermediate	90	32.20%	66.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0419990751	G -> DEL	N	N	silent_mutation	Average:40.989; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0419990751	G -> A	LOC_Os04g33030.1	upstream_gene_variant ; 3666.0bp to feature; MODIFIER	silent_mutation	Average:40.989; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0419990751	G -> A	LOC_Os04g33030.2	upstream_gene_variant ; 3725.0bp to feature; MODIFIER	silent_mutation	Average:40.989; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0419990751	G -> A	LOC_Os04g33020-LOC_Os04g33030	intergenic_region ; MODIFIER	silent_mutation	Average:40.989; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0419990751	NA	7.90E-06	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419990751	NA	9.94E-06	mr1734	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419990751	NA	1.78E-06	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419990751	4.28E-06	NA	mr1693_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419990751	NA	1.24E-06	mr1702_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419990751	NA	1.34E-06	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419990751	NA	9.38E-07	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419990751	NA	1.72E-08	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251