\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419912063:

Variant ID: vg0419912063 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 19912063
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGCTACAGTATTTTCGTCACGCTACAGTGTTTTCTGAGGCGGACGAAACGTCCGCCATACTCCTGTGGCGAGCCACGCCGTGGCGTGGCATTCCAAGCC[G/A]
CCAACCAAGCAACCCCTTAGTCTTTTGCACTCTATACGGCTCACGCCGACGTCCTGATGCTGCTCTTGTGATCGACAGTGCTGGTATTTTAGATATGAGA

Reverse complement sequence

TCTCATATCTAAAATACCAGCACTGTCGATCACAAGAGCAGCATCAGGACGTCGGCGTGAGCCGTATAGAGTGCAAAAGACTAAGGGGTTGCTTGGTTGG[C/T]
GGCTTGGAATGCCACGCCACGGCGTGGCTCGCCACAGGAGTATGGCGGACGTTTCGTCCGCCTCAGAAAACACTGTAGCGTGACGAAAATACTGTAGCTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 26.10% 18.00% 2.67% 53.20% NA
All Indica  2759 6.60% 4.20% 3.41% 85.86% NA
All Japonica  1512 55.50% 42.30% 0.66% 1.52% NA
Aus  269 59.90% 5.60% 6.32% 28.25% NA
Indica I  595 3.50% 2.90% 4.20% 89.41% NA
Indica II  465 15.10% 6.70% 3.01% 75.27% NA
Indica III  913 2.80% 1.60% 1.42% 94.09% NA
Indica Intermediate  786 8.10% 6.60% 5.34% 79.90% NA
Temperate Japonica  767 79.00% 18.40% 1.04% 1.56% NA
Tropical Japonica  504 34.70% 63.50% 0.20% 1.59% NA
Japonica Intermediate  241 24.10% 74.30% 0.41% 1.24% NA
VI/Aromatic  96 21.90% 53.10% 1.04% 23.96% NA
Intermediate  90 35.60% 34.40% 4.44% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0419912063 G -> DEL N N silent_mutation Average:81.569; most accessible tissue: Callus, score: 94.084 N N N N
vg0419912063 G -> A LOC_Os04g32950.1 downstream_gene_variant ; 1165.0bp to feature; MODIFIER silent_mutation Average:81.569; most accessible tissue: Callus, score: 94.084 N N N N
vg0419912063 G -> A LOC_Os04g32950.2 downstream_gene_variant ; 1165.0bp to feature; MODIFIER silent_mutation Average:81.569; most accessible tissue: Callus, score: 94.084 N N N N
vg0419912063 G -> A LOC_Os04g32950.3 downstream_gene_variant ; 1165.0bp to feature; MODIFIER silent_mutation Average:81.569; most accessible tissue: Callus, score: 94.084 N N N N
vg0419912063 G -> A LOC_Os04g32950.4 downstream_gene_variant ; 1165.0bp to feature; MODIFIER silent_mutation Average:81.569; most accessible tissue: Callus, score: 94.084 N N N N
vg0419912063 G -> A LOC_Os04g32940-LOC_Os04g32950 intergenic_region ; MODIFIER silent_mutation Average:81.569; most accessible tissue: Callus, score: 94.084 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0419912063 NA 3.78E-08 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 NA 1.78E-06 mr1602 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 NA 8.28E-06 mr1852 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 NA 9.12E-06 mr1043_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 NA 3.34E-06 mr1045_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 NA 4.13E-10 mr1051_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 1.52E-06 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 NA 9.58E-09 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 NA 4.63E-07 mr1084_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 1.10E-06 1.10E-06 mr1145_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 NA 5.55E-06 mr1149_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 NA 3.87E-09 mr1155_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 NA 4.62E-07 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 8.24E-06 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 NA 5.38E-10 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 NA 1.47E-06 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 NA 5.33E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 8.81E-06 8.81E-06 mr1302_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 NA 1.04E-06 mr1318_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 NA 1.11E-07 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 NA 2.24E-07 mr1405_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 3.23E-06 NA mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 NA 1.45E-06 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 NA 4.30E-06 mr1437_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 NA 8.18E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 NA 5.34E-06 mr1482_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 NA 2.05E-07 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 NA 7.14E-08 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 NA 8.11E-06 mr1555_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 NA 1.60E-07 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 NA 4.21E-06 mr1591_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 NA 2.27E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 NA 4.17E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 NA 7.62E-06 mr1620_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 NA 7.85E-06 mr1646_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 NA 7.98E-06 mr1693_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 NA 5.09E-06 mr1729_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 NA 9.76E-06 mr1736_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 NA 1.59E-06 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 NA 3.09E-08 mr1788_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 NA 1.48E-06 mr1813_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 NA 2.83E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 NA 1.17E-07 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 NA 5.72E-10 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063 NA 2.23E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251