Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419912063:

Variant ID: vg0419912063 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 19912063
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGCTACAGTATTTTCGTCACGCTACAGTGTTTTCTGAGGCGGACGAAACGTCCGCCATACTCCTGTGGCGAGCCACGCCGTGGCGTGGCATTCCAAGCC[G/A]
CCAACCAAGCAACCCCTTAGTCTTTTGCACTCTATACGGCTCACGCCGACGTCCTGATGCTGCTCTTGTGATCGACAGTGCTGGTATTTTAGATATGAGA

Reverse complement sequence

TCTCATATCTAAAATACCAGCACTGTCGATCACAAGAGCAGCATCAGGACGTCGGCGTGAGCCGTATAGAGTGCAAAAGACTAAGGGGTTGCTTGGTTGG[C/T]
GGCTTGGAATGCCACGCCACGGCGTGGCTCGCCACAGGAGTATGGCGGACGTTTCGTCCGCCTCAGAAAACACTGTAGCGTGACGAAAATACTGTAGCTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	26.10%	18.00%	2.67%	53.20%	NA
All Indica	2759	6.60%	4.20%	3.41%	85.86%	NA
All Japonica	1512	55.50%	42.30%	0.66%	1.52%	NA
Aus	269	59.90%	5.60%	6.32%	28.25%	NA
Indica I	595	3.50%	2.90%	4.20%	89.41%	NA
Indica II	465	15.10%	6.70%	3.01%	75.27%	NA
Indica III	913	2.80%	1.60%	1.42%	94.09%	NA
Indica Intermediate	786	8.10%	6.60%	5.34%	79.90%	NA
Temperate Japonica	767	79.00%	18.40%	1.04%	1.56%	NA
Tropical Japonica	504	34.70%	63.50%	0.20%	1.59%	NA
Japonica Intermediate	241	24.10%	74.30%	0.41%	1.24%	NA
VI/Aromatic	96	21.90%	53.10%	1.04%	23.96%	NA
Intermediate	90	35.60%	34.40%	4.44%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0419912063	G -> DEL	N	N	silent_mutation	Average:81.569; most accessible tissue: Callus, score: 94.084	N	N	N	N
vg0419912063	G -> A	LOC_Os04g32950.1	downstream_gene_variant ; 1165.0bp to feature; MODIFIER	silent_mutation	Average:81.569; most accessible tissue: Callus, score: 94.084	N	N	N	N
vg0419912063	G -> A	LOC_Os04g32950.2	downstream_gene_variant ; 1165.0bp to feature; MODIFIER	silent_mutation	Average:81.569; most accessible tissue: Callus, score: 94.084	N	N	N	N
vg0419912063	G -> A	LOC_Os04g32950.3	downstream_gene_variant ; 1165.0bp to feature; MODIFIER	silent_mutation	Average:81.569; most accessible tissue: Callus, score: 94.084	N	N	N	N
vg0419912063	G -> A	LOC_Os04g32950.4	downstream_gene_variant ; 1165.0bp to feature; MODIFIER	silent_mutation	Average:81.569; most accessible tissue: Callus, score: 94.084	N	N	N	N
vg0419912063	G -> A	LOC_Os04g32940-LOC_Os04g32950	intergenic_region ; MODIFIER	silent_mutation	Average:81.569; most accessible tissue: Callus, score: 94.084	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0419912063	NA	3.78E-08	mr1554	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	NA	1.78E-06	mr1602	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	NA	8.28E-06	mr1852	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	NA	9.12E-06	mr1043_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	NA	3.34E-06	mr1045_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	NA	4.13E-10	mr1051_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	1.52E-06	NA	mr1083_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	NA	9.58E-09	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	NA	4.63E-07	mr1084_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	1.10E-06	1.10E-06	mr1145_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	NA	5.55E-06	mr1149_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	NA	3.87E-09	mr1155_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	NA	4.62E-07	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	8.24E-06	NA	mr1226_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	NA	5.38E-10	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	NA	1.47E-06	mr1263_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	NA	5.33E-07	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	8.81E-06	8.81E-06	mr1302_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	NA	1.04E-06	mr1318_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	NA	1.11E-07	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	NA	2.24E-07	mr1405_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	3.23E-06	NA	mr1408_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	NA	1.45E-06	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	NA	4.30E-06	mr1437_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	NA	8.18E-07	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	NA	5.34E-06	mr1482_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	NA	2.05E-07	mr1502_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	NA	7.14E-08	mr1521_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	NA	8.11E-06	mr1555_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	NA	1.60E-07	mr1570_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	NA	4.21E-06	mr1591_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	NA	2.27E-06	mr1596_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	NA	4.17E-06	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	NA	7.62E-06	mr1620_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	NA	7.85E-06	mr1646_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	NA	7.98E-06	mr1693_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	NA	5.09E-06	mr1729_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	NA	9.76E-06	mr1736_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	NA	1.59E-06	mr1741_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	NA	3.09E-08	mr1788_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	NA	1.48E-06	mr1813_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	NA	2.83E-09	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	NA	1.17E-07	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	NA	5.72E-10	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912063	NA	2.23E-06	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251