\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419906517:

Variant ID: vg0419906517 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 19906517
Reference Allele: GGTAAAGTTGCTAAAAAAAlternative Allele: AGTAAAGTTGCTAAAAAA,G
Primary Allele: GGTAAAGTTGCTAAAAAASecondary Allele: AGTAAAGTTGCTAAAAAA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAAACATCATGTGAACCCACGGGGCCTCGCTTGGCTATTGGCTATATATTAAGTTCGGGCCTGTTTACTTTGATACCATTTTCAATCTTACCAAATTTT[GGTAAAGTTGCTAAAAAA/AGTAAAGTTGCTAAAAAA,G]
ATAGCTATATTTAGTTTGCTACTAAATTAAAGTGTACATGCCCTTTATTTTGGCCCAGTCAGGCGGTCATAAATGACAATATGTTTCTTGTGATTTAGGA

Reverse complement sequence

TCCTAAATCACAAGAAACATATTGTCATTTATGACCGCCTGACTGGGCCAAAATAAAGGGCATGTACACTTTAATTTAGTAGCAAACTAAATATAGCTAT[TTTTTTAGCAACTTTACC/TTTTTTAGCAACTTTACT,C]
AAAATTTGGTAAGATTGAAAATGGTATCAAAGTAAACAGGCCCGAACTTAATATATAGCCAATAGCCAAGCGAGGCCCCGTGGGTTCACATGATGTTTTT

Allele Frequencies:

Populations Population SizeFrequency of GGTAAAGTTGCTAAAAAA(primary allele) Frequency of AGTAAAGTTGCTAAAAAA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.80% 8.00% 0.47% 0.34% G: 0.36%
All Indica  2759 97.20% 0.80% 0.80% 0.58% G: 0.62%
All Japonica  1512 78.40% 21.60% 0.00% 0.00% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 98.50% 0.70% 0.34% 0.50% NA
Indica II  465 98.30% 0.20% 1.08% 0.43% NA
Indica III  913 95.30% 1.40% 0.66% 0.88% G: 1.75%
Indica Intermediate  786 97.80% 0.50% 1.15% 0.38% G: 0.13%
Temperate Japonica  767 81.60% 18.40% 0.00% 0.00% NA
Tropical Japonica  504 65.90% 34.10% 0.00% 0.00% NA
Japonica Intermediate  241 94.20% 5.80% 0.00% 0.00% NA
VI/Aromatic  96 84.40% 15.60% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0419906517 GGTAAAGTTGCTAAAAAA -> G LOC_Os04g32940.1 upstream_gene_variant ; 2861.0bp to feature; MODIFIER silent_mutation Average:74.709; most accessible tissue: Callus, score: 89.057 N N N N
vg0419906517 GGTAAAGTTGCTAAAAAA -> G LOC_Os04g32940-LOC_Os04g32950 intergenic_region ; MODIFIER silent_mutation Average:74.709; most accessible tissue: Callus, score: 89.057 N N N N
vg0419906517 GGTAAAGTTGCTAAAAAA -> DEL N N silent_mutation Average:74.709; most accessible tissue: Callus, score: 89.057 N N N N
vg0419906517 GGTAAAGTTGCTAAAAAA -> AGTAAAGTTGCTAAAAAA LOC_Os04g32940.1 upstream_gene_variant ; 2860.0bp to feature; MODIFIER silent_mutation Average:74.709; most accessible tissue: Callus, score: 89.057 N N N N
vg0419906517 GGTAAAGTTGCTAAAAAA -> AGTAAAGTTGCTAAAAAA LOC_Os04g32940-LOC_Os04g32950 intergenic_region ; MODIFIER silent_mutation Average:74.709; most accessible tissue: Callus, score: 89.057 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0419906517 GGTAA* AGTAA* 0.01 0.01 0.0 0.01 0.0 0.0
vg0419906517 GGTAA* G 0.05 0.01 0.1 0.08 0.12 0.13

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0419906517 NA 9.25E-17 Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0419906517 1.24E-06 1.24E-06 mr1076_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419906517 3.07E-08 NA mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419906517 8.46E-06 4.41E-07 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419906517 1.21E-08 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419906517 NA 1.84E-07 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419906517 4.47E-06 NA mr1085_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419906517 NA 5.95E-06 mr1085_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419906517 9.66E-07 NA mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419906517 5.72E-07 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419906517 6.36E-11 NA mr1107_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419906517 6.39E-07 2.83E-07 mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419906517 6.19E-06 NA mr1145_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419906517 7.18E-07 7.18E-07 mr1145_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419906517 7.65E-10 NA mr1226_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419906517 NA 4.78E-07 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419906517 1.17E-08 8.51E-12 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419906517 9.18E-07 2.76E-09 mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419906517 NA 9.95E-06 mr1949_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251