Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0419906492:

Variant ID: vg0419906492 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 19906492
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.82, A: 0.18, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

ACACGAAAAGCTTTTTTTTTAAAAAAAAAACATCATGTGAACCCACGGGGCCTCGCTTGGCTATTGGCTATATATTAAGTTCGGGCCTGTTTACTTTGAT[A/G]
CCATTTTCAATCTTACCAAATTTTGGTAAAGTTGCTAAAAAAATAGCTATATTTAGTTTGCTACTAAATTAAAGTGTACATGCCCTTTATTTTGGCCCAG

Reverse complement sequence

CTGGGCCAAAATAAAGGGCATGTACACTTTAATTTAGTAGCAAACTAAATATAGCTATTTTTTTAGCAACTTTACCAAAATTTGGTAAGATTGAAAATGG[T/C]
ATCAAAGTAAACAGGCCCGAACTTAATATATAGCCAATAGCCAAGCGAGGCCCCGTGGGTTCACATGATGTTTTTTTTTTAAAAAAAAAGCTTTTCGTGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.90%	38.70%	0.44%	0.00%	NA
All Indica	2759	80.20%	19.20%	0.58%	0.00%	NA
All Japonica	1512	22.20%	77.60%	0.20%	0.00%	NA
Aus	269	92.90%	6.70%	0.37%	0.00%	NA
Indica I	595	95.10%	4.50%	0.34%	0.00%	NA
Indica II	465	82.80%	16.80%	0.43%	0.00%	NA
Indica III	913	67.60%	31.70%	0.77%	0.00%	NA
Indica Intermediate	786	82.10%	17.30%	0.64%	0.00%	NA
Temperate Japonica	767	18.30%	81.60%	0.13%	0.00%	NA
Tropical Japonica	504	35.30%	64.30%	0.40%	0.00%	NA
Japonica Intermediate	241	7.10%	92.90%	0.00%	0.00%	NA
VI/Aromatic	96	44.80%	55.20%	0.00%	0.00%	NA
Intermediate	90	40.00%	58.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0419906492	A -> G	LOC_Os04g32940.1	upstream_gene_variant ; 2835.0bp to feature; MODIFIER	silent_mutation	Average:74.432; most accessible tissue: Callus, score: 89.057	N	N	N	N
vg0419906492	A -> G	LOC_Os04g32940-LOC_Os04g32950	intergenic_region ; MODIFIER	silent_mutation	Average:74.432; most accessible tissue: Callus, score: 89.057	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0419906492	A	G	-0.02	-0.02	-0.02	-0.02	-0.02	-0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0419906492	1.24E-06	1.24E-06	mr1076_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419906492	8.46E-06	4.41E-07	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419906492	NA	1.84E-07	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419906492	NA	5.95E-06	mr1085_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419906492	1.57E-06	NA	mr1107_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419906492	6.39E-07	2.83E-07	mr1107_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419906492	7.18E-07	7.18E-07	mr1145_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419906492	NA	4.78E-07	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419906492	9.18E-07	2.76E-09	mr1408_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419906492	NA	6.35E-07	mr1619_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419906492	NA	9.95E-06	mr1949_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251