\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419889132:

Variant ID: vg0419889132 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 19889132
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGAGTTGGGTTTCGGGCGATCTTGGCTGTGTTCCGTTGTTGGTTTAGCGGCAATCGGTCACGCTTAGTGGTGGCCGGTTCGGTGCTAGCCTTCTTCTGGG[G/C]
CTGTGTGTTGGTGCTGTCGGTGTGTGGGTGGTGGTATACTTTTTTTTCCTAGTTACGATCTTCCGAGGTTATAATCTTGCAATTTTTTCCTACTCTATCT

Reverse complement sequence

AGATAGAGTAGGAAAAAATTGCAAGATTATAACCTCGGAAGATCGTAACTAGGAAAAAAAAGTATACCACCACCCACACACCGACAGCACCAACACACAG[C/G]
CCCAGAAGAAGGCTAGCACCGAACCGGCCACCACTAAGCGTGACCGATTGCCGCTAAACCAACAACGGAACACAGCCAAGATCGCCCGAAACCCAACTCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.60% 25.70% 0.30% 0.40% NA
All Indica  2759 94.90% 4.70% 0.18% 0.14% NA
All Japonica  1512 35.60% 63.00% 0.40% 0.99% NA
Aus  269 92.90% 7.10% 0.00% 0.00% NA
Indica I  595 94.60% 4.90% 0.34% 0.17% NA
Indica II  465 92.50% 6.90% 0.43% 0.22% NA
Indica III  913 97.70% 2.20% 0.00% 0.11% NA
Indica Intermediate  786 93.40% 6.40% 0.13% 0.13% NA
Temperate Japonica  767 63.00% 35.10% 0.13% 1.83% NA
Tropical Japonica  504 1.80% 97.60% 0.60% 0.00% NA
Japonica Intermediate  241 19.50% 79.30% 0.83% 0.41% NA
VI/Aromatic  96 28.10% 70.80% 1.04% 0.00% NA
Intermediate  90 48.90% 48.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0419889132 G -> C LOC_Os04g32910.1 upstream_gene_variant ; 4561.0bp to feature; MODIFIER silent_mutation Average:82.287; most accessible tissue: Zhenshan97 flower, score: 93.03 N N N N
vg0419889132 G -> C LOC_Os04g32930.1 downstream_gene_variant ; 4252.0bp to feature; MODIFIER silent_mutation Average:82.287; most accessible tissue: Zhenshan97 flower, score: 93.03 N N N N
vg0419889132 G -> C LOC_Os04g32920.1 intron_variant ; MODIFIER silent_mutation Average:82.287; most accessible tissue: Zhenshan97 flower, score: 93.03 N N N N
vg0419889132 G -> C LOC_Os04g32920.3 intron_variant ; MODIFIER silent_mutation Average:82.287; most accessible tissue: Zhenshan97 flower, score: 93.03 N N N N
vg0419889132 G -> C LOC_Os04g32920.2 intron_variant ; MODIFIER silent_mutation Average:82.287; most accessible tissue: Zhenshan97 flower, score: 93.03 N N N N
vg0419889132 G -> C LOC_Os04g32920.5 intron_variant ; MODIFIER silent_mutation Average:82.287; most accessible tissue: Zhenshan97 flower, score: 93.03 N N N N
vg0419889132 G -> C LOC_Os04g32920.4 intron_variant ; MODIFIER silent_mutation Average:82.287; most accessible tissue: Zhenshan97 flower, score: 93.03 N N N N
vg0419889132 G -> DEL N N silent_mutation Average:82.287; most accessible tissue: Zhenshan97 flower, score: 93.03 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0419889132 G C 0.02 0.02 0.02 0.04 0.04 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0419889132 NA 2.12E-06 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419889132 NA 8.26E-06 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419889132 NA 9.51E-06 mr1069 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419889132 NA 3.14E-11 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419889132 NA 2.23E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419889132 NA 2.20E-08 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419889132 NA 9.60E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419889132 NA 1.13E-12 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419889132 NA 5.05E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419889132 NA 1.99E-06 mr1441 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419889132 NA 1.18E-07 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419889132 NA 2.49E-17 mr1521 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419889132 NA 7.55E-08 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419889132 NA 1.05E-09 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419889132 NA 2.59E-08 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419889132 NA 2.75E-06 mr1794 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419889132 NA 7.41E-07 mr1851 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419889132 NA 2.76E-06 mr1852 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419889132 NA 2.73E-11 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419889132 NA 1.22E-10 mr1880 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419889132 NA 1.30E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419889132 NA 4.77E-12 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419889132 NA 1.56E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419889132 NA 8.75E-07 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419889132 NA 4.27E-07 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419889132 NA 4.66E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419889132 NA 2.64E-07 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419889132 NA 4.53E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251