\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419848656:

Variant ID: vg0419848656 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 19848656
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.09, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TACTTTTATAAATATTATTGATCAAAATAGCATCTCGAATACCATGTCAGAGTTCAAAAATACTTATCTTTTAGTACGGATGGAGTAGTTGACTGAGTCG[C/T]
GGAAGTTTTTTCACACTTTCATCTAAATAAGACCCAAATAAAATGCGAGTTACACGGCCAACAAACCCCCATTCGATGACCGCTTCCATTAAAATGCTAG

Reverse complement sequence

CTAGCATTTTAATGGAAGCGGTCATCGAATGGGGGTTTGTTGGCCGTGTAACTCGCATTTTATTTGGGTCTTATTTAGATGAAAGTGTGAAAAAACTTCC[G/A]
CGACTCAGTCAACTACTCCATCCGTACTAAAAGATAAGTATTTTTGAACTCTGACATGGTATTCGAGATGCTATTTTGATCAATAATATTTATAAAAGTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.70% 43.20% 1.10% 0.00% NA
All Indica  2759 88.50% 10.60% 0.91% 0.00% NA
All Japonica  1512 0.50% 99.50% 0.00% 0.00% NA
Aus  269 55.80% 36.80% 7.43% 0.00% NA
Indica I  595 84.50% 14.60% 0.84% 0.00% NA
Indica II  465 87.10% 12.70% 0.22% 0.00% NA
Indica III  913 95.40% 3.70% 0.88% 0.00% NA
Indica Intermediate  786 84.40% 14.20% 1.40% 0.00% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 1.20% 98.80% 0.00% 0.00% NA
Japonica Intermediate  241 0.00% 100.00% 0.00% 0.00% NA
VI/Aromatic  96 14.60% 79.20% 6.25% 0.00% NA
Intermediate  90 22.20% 76.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0419848656 C -> T LOC_Os04g32860.1 upstream_gene_variant ; 4380.0bp to feature; MODIFIER silent_mutation Average:55.272; most accessible tissue: Minghui63 flower, score: 77.644 N N N N
vg0419848656 C -> T LOC_Os04g32870.1 upstream_gene_variant ; 462.0bp to feature; MODIFIER silent_mutation Average:55.272; most accessible tissue: Minghui63 flower, score: 77.644 N N N N
vg0419848656 C -> T LOC_Os04g32880.1 downstream_gene_variant ; 2315.0bp to feature; MODIFIER silent_mutation Average:55.272; most accessible tissue: Minghui63 flower, score: 77.644 N N N N
vg0419848656 C -> T LOC_Os04g32880.2 downstream_gene_variant ; 2720.0bp to feature; MODIFIER silent_mutation Average:55.272; most accessible tissue: Minghui63 flower, score: 77.644 N N N N
vg0419848656 C -> T LOC_Os04g32880.4 downstream_gene_variant ; 2720.0bp to feature; MODIFIER silent_mutation Average:55.272; most accessible tissue: Minghui63 flower, score: 77.644 N N N N
vg0419848656 C -> T LOC_Os04g32880.5 downstream_gene_variant ; 2720.0bp to feature; MODIFIER silent_mutation Average:55.272; most accessible tissue: Minghui63 flower, score: 77.644 N N N N
vg0419848656 C -> T LOC_Os04g32880.3 downstream_gene_variant ; 3666.0bp to feature; MODIFIER silent_mutation Average:55.272; most accessible tissue: Minghui63 flower, score: 77.644 N N N N
vg0419848656 C -> T LOC_Os04g32860-LOC_Os04g32870 intergenic_region ; MODIFIER silent_mutation Average:55.272; most accessible tissue: Minghui63 flower, score: 77.644 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0419848656 C T 0.01 0.0 -0.01 -0.01 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0419848656 NA 2.92E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419848656 NA 8.21E-08 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419848656 NA 7.01E-06 mr1371_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419848656 1.13E-06 3.06E-07 mr1371_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419848656 NA 5.51E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419848656 NA 8.33E-08 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419848656 NA 6.43E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419848656 NA 4.50E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419848656 NA 1.44E-17 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419848656 NA 9.25E-06 mr1712_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419848656 NA 1.75E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419848656 NA 3.75E-10 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419848656 NA 1.45E-13 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419848656 NA 6.12E-16 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419848656 NA 1.92E-10 mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419848656 NA 1.34E-06 mr1946_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419848656 NA 1.92E-10 mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419848656 NA 1.34E-06 mr1948_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419848656 1.49E-06 3.01E-07 mr1977_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251