Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419847240:

Variant ID: vg0419847240 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 19847240
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.20, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

CTTAGCAATCATATACTTCCTCCATTCCAAAATATTGCTATCTAGGATGGGATTTGACCAATCCTATGATAACGAATCTGAACAAAGGCATGTCGAGATT[T/C]
GTTGTCATAGGATGGGTCAAATCCTATCCTAAATAGCAACATTTTAGGACAGAGGAAAGAAGTCGGGCAACAAAATTGACAAAAAAAATCCATAAAACTA

Reverse complement sequence

TAGTTTTATGGATTTTTTTTGTCAATTTTGTTGCCCGACTTCTTTCCTCTGTCCTAAAATGTTGCTATTTAGGATAGGATTTGACCCATCCTATGACAAC[A/G]
AATCTCGACATGCCTTTGTTCAGATTCGTTATCATAGGATTGGTCAAATCCCATCCTAGATAGCAATATTTTGGAATGGAGGAAGTATATGATTGCTAAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.10%	40.40%	0.44%	0.04%	NA
All Indica	2759	89.90%	9.70%	0.40%	0.04%	NA
All Japonica	1512	0.90%	98.70%	0.33%	0.00%	NA
Aus	269	94.10%	5.20%	0.74%	0.00%	NA
Indica I	595	84.70%	14.10%	1.01%	0.17%	NA
Indica II	465	87.50%	12.00%	0.43%	0.00%	NA
Indica III	913	96.50%	3.40%	0.11%	0.00%	NA
Indica Intermediate	786	87.40%	12.30%	0.25%	0.00%	NA
Temperate Japonica	767	0.90%	98.70%	0.39%	0.00%	NA
Tropical Japonica	504	1.20%	98.80%	0.00%	0.00%	NA
Japonica Intermediate	241	0.40%	98.80%	0.83%	0.00%	NA
VI/Aromatic	96	25.00%	72.90%	2.08%	0.00%	NA
Intermediate	90	27.80%	70.00%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0419847240	T -> C	LOC_Os04g32860.1	upstream_gene_variant ; 2964.0bp to feature; MODIFIER	silent_mutation	Average:48.088; most accessible tissue: Callus, score: 75.456	N	N	N	N
vg0419847240	T -> C	LOC_Os04g32870.1	upstream_gene_variant ; 1878.0bp to feature; MODIFIER	silent_mutation	Average:48.088; most accessible tissue: Callus, score: 75.456	N	N	N	N
vg0419847240	T -> C	LOC_Os04g32880.1	downstream_gene_variant ; 3731.0bp to feature; MODIFIER	silent_mutation	Average:48.088; most accessible tissue: Callus, score: 75.456	N	N	N	N
vg0419847240	T -> C	LOC_Os04g32880.2	downstream_gene_variant ; 4136.0bp to feature; MODIFIER	silent_mutation	Average:48.088; most accessible tissue: Callus, score: 75.456	N	N	N	N
vg0419847240	T -> C	LOC_Os04g32880.4	downstream_gene_variant ; 4136.0bp to feature; MODIFIER	silent_mutation	Average:48.088; most accessible tissue: Callus, score: 75.456	N	N	N	N
vg0419847240	T -> C	LOC_Os04g32880.5	downstream_gene_variant ; 4136.0bp to feature; MODIFIER	silent_mutation	Average:48.088; most accessible tissue: Callus, score: 75.456	N	N	N	N
vg0419847240	T -> C	LOC_Os04g32860-LOC_Os04g32870	intergenic_region ; MODIFIER	silent_mutation	Average:48.088; most accessible tissue: Callus, score: 75.456	N	N	N	N
vg0419847240	T -> DEL	N	N	silent_mutation	Average:48.088; most accessible tissue: Callus, score: 75.456	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0419847240	NA	8.75E-16	mr1040_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240	NA	2.09E-09	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240	NA	4.60E-21	mr1362_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240	NA	2.44E-06	mr1371_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240	NA	7.87E-12	mr1537_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240	NA	1.14E-06	mr1568_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240	NA	6.12E-10	mr1595_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240	NA	5.64E-08	mr1645_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240	NA	2.56E-18	mr1657_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240	NA	6.29E-09	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240	NA	5.66E-18	mr1712_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240	NA	3.50E-08	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240	NA	4.00E-11	mr1756_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240	NA	1.47E-15	mr1770_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240	NA	2.18E-07	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240	NA	6.16E-16	mr1836_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240	NA	3.57E-06	mr1915_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240	NA	1.38E-10	mr1946_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240	7.62E-06	3.85E-07	mr1946_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240	NA	1.38E-10	mr1948_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240	7.62E-06	3.85E-07	mr1948_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240	NA	5.15E-06	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240	2.11E-06	1.22E-07	mr1977_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251