\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419847240:

Variant ID: vg0419847240 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 19847240
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.20, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


CTTAGCAATCATATACTTCCTCCATTCCAAAATATTGCTATCTAGGATGGGATTTGACCAATCCTATGATAACGAATCTGAACAAAGGCATGTCGAGATT[T/C]
GTTGTCATAGGATGGGTCAAATCCTATCCTAAATAGCAACATTTTAGGACAGAGGAAAGAAGTCGGGCAACAAAATTGACAAAAAAAATCCATAAAACTA

Reverse complement sequence

TAGTTTTATGGATTTTTTTTGTCAATTTTGTTGCCCGACTTCTTTCCTCTGTCCTAAAATGTTGCTATTTAGGATAGGATTTGACCCATCCTATGACAAC[A/G]
AATCTCGACATGCCTTTGTTCAGATTCGTTATCATAGGATTGGTCAAATCCCATCCTAGATAGCAATATTTTGGAATGGAGGAAGTATATGATTGCTAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.10% 40.40% 0.44% 0.04% NA
All Indica  2759 89.90% 9.70% 0.40% 0.04% NA
All Japonica  1512 0.90% 98.70% 0.33% 0.00% NA
Aus  269 94.10% 5.20% 0.74% 0.00% NA
Indica I  595 84.70% 14.10% 1.01% 0.17% NA
Indica II  465 87.50% 12.00% 0.43% 0.00% NA
Indica III  913 96.50% 3.40% 0.11% 0.00% NA
Indica Intermediate  786 87.40% 12.30% 0.25% 0.00% NA
Temperate Japonica  767 0.90% 98.70% 0.39% 0.00% NA
Tropical Japonica  504 1.20% 98.80% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 98.80% 0.83% 0.00% NA
VI/Aromatic  96 25.00% 72.90% 2.08% 0.00% NA
Intermediate  90 27.80% 70.00% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0419847240 T -> C LOC_Os04g32860.1 upstream_gene_variant ; 2964.0bp to feature; MODIFIER silent_mutation Average:48.088; most accessible tissue: Callus, score: 75.456 N N N N
vg0419847240 T -> C LOC_Os04g32870.1 upstream_gene_variant ; 1878.0bp to feature; MODIFIER silent_mutation Average:48.088; most accessible tissue: Callus, score: 75.456 N N N N
vg0419847240 T -> C LOC_Os04g32880.1 downstream_gene_variant ; 3731.0bp to feature; MODIFIER silent_mutation Average:48.088; most accessible tissue: Callus, score: 75.456 N N N N
vg0419847240 T -> C LOC_Os04g32880.2 downstream_gene_variant ; 4136.0bp to feature; MODIFIER silent_mutation Average:48.088; most accessible tissue: Callus, score: 75.456 N N N N
vg0419847240 T -> C LOC_Os04g32880.4 downstream_gene_variant ; 4136.0bp to feature; MODIFIER silent_mutation Average:48.088; most accessible tissue: Callus, score: 75.456 N N N N
vg0419847240 T -> C LOC_Os04g32880.5 downstream_gene_variant ; 4136.0bp to feature; MODIFIER silent_mutation Average:48.088; most accessible tissue: Callus, score: 75.456 N N N N
vg0419847240 T -> C LOC_Os04g32860-LOC_Os04g32870 intergenic_region ; MODIFIER silent_mutation Average:48.088; most accessible tissue: Callus, score: 75.456 N N N N
vg0419847240 T -> DEL N N silent_mutation Average:48.088; most accessible tissue: Callus, score: 75.456 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0419847240 NA 8.75E-16 mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240 NA 2.09E-09 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240 NA 4.60E-21 mr1362_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240 NA 2.44E-06 mr1371_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240 NA 7.87E-12 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240 NA 1.14E-06 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240 NA 6.12E-10 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240 NA 5.64E-08 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240 NA 2.56E-18 mr1657_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240 NA 6.29E-09 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240 NA 5.66E-18 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240 NA 3.50E-08 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240 NA 4.00E-11 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240 NA 1.47E-15 mr1770_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240 NA 2.18E-07 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240 NA 6.16E-16 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240 NA 3.57E-06 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240 NA 1.38E-10 mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240 7.62E-06 3.85E-07 mr1946_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240 NA 1.38E-10 mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240 7.62E-06 3.85E-07 mr1948_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240 NA 5.15E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419847240 2.11E-06 1.22E-07 mr1977_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251