\
| Variant ID: vg0419847240 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 19847240 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.20, others allele: 0.00, population size: 97. )
CTTAGCAATCATATACTTCCTCCATTCCAAAATATTGCTATCTAGGATGGGATTTGACCAATCCTATGATAACGAATCTGAACAAAGGCATGTCGAGATT[T/C]
GTTGTCATAGGATGGGTCAAATCCTATCCTAAATAGCAACATTTTAGGACAGAGGAAAGAAGTCGGGCAACAAAATTGACAAAAAAAATCCATAAAACTA
TAGTTTTATGGATTTTTTTTGTCAATTTTGTTGCCCGACTTCTTTCCTCTGTCCTAAAATGTTGCTATTTAGGATAGGATTTGACCCATCCTATGACAAC[A/G]
AATCTCGACATGCCTTTGTTCAGATTCGTTATCATAGGATTGGTCAAATCCCATCCTAGATAGCAATATTTTGGAATGGAGGAAGTATATGATTGCTAAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.10% | 40.40% | 0.44% | 0.04% | NA |
| All Indica | 2759 | 89.90% | 9.70% | 0.40% | 0.04% | NA |
| All Japonica | 1512 | 0.90% | 98.70% | 0.33% | 0.00% | NA |
| Aus | 269 | 94.10% | 5.20% | 0.74% | 0.00% | NA |
| Indica I | 595 | 84.70% | 14.10% | 1.01% | 0.17% | NA |
| Indica II | 465 | 87.50% | 12.00% | 0.43% | 0.00% | NA |
| Indica III | 913 | 96.50% | 3.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 87.40% | 12.30% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 0.90% | 98.70% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.40% | 98.80% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 25.00% | 72.90% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 27.80% | 70.00% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0419847240 | T -> C | LOC_Os04g32860.1 | upstream_gene_variant ; 2964.0bp to feature; MODIFIER | silent_mutation | Average:48.088; most accessible tissue: Callus, score: 75.456 | N | N | N | N |
| vg0419847240 | T -> C | LOC_Os04g32870.1 | upstream_gene_variant ; 1878.0bp to feature; MODIFIER | silent_mutation | Average:48.088; most accessible tissue: Callus, score: 75.456 | N | N | N | N |
| vg0419847240 | T -> C | LOC_Os04g32880.1 | downstream_gene_variant ; 3731.0bp to feature; MODIFIER | silent_mutation | Average:48.088; most accessible tissue: Callus, score: 75.456 | N | N | N | N |
| vg0419847240 | T -> C | LOC_Os04g32880.2 | downstream_gene_variant ; 4136.0bp to feature; MODIFIER | silent_mutation | Average:48.088; most accessible tissue: Callus, score: 75.456 | N | N | N | N |
| vg0419847240 | T -> C | LOC_Os04g32880.4 | downstream_gene_variant ; 4136.0bp to feature; MODIFIER | silent_mutation | Average:48.088; most accessible tissue: Callus, score: 75.456 | N | N | N | N |
| vg0419847240 | T -> C | LOC_Os04g32880.5 | downstream_gene_variant ; 4136.0bp to feature; MODIFIER | silent_mutation | Average:48.088; most accessible tissue: Callus, score: 75.456 | N | N | N | N |
| vg0419847240 | T -> C | LOC_Os04g32860-LOC_Os04g32870 | intergenic_region ; MODIFIER | silent_mutation | Average:48.088; most accessible tissue: Callus, score: 75.456 | N | N | N | N |
| vg0419847240 | T -> DEL | N | N | silent_mutation | Average:48.088; most accessible tissue: Callus, score: 75.456 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0419847240 | NA | 8.75E-16 | mr1040_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419847240 | NA | 2.09E-09 | mr1299_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419847240 | NA | 4.60E-21 | mr1362_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419847240 | NA | 2.44E-06 | mr1371_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419847240 | NA | 7.87E-12 | mr1537_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419847240 | NA | 1.14E-06 | mr1568_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419847240 | NA | 6.12E-10 | mr1595_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419847240 | NA | 5.64E-08 | mr1645_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419847240 | NA | 2.56E-18 | mr1657_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419847240 | NA | 6.29E-09 | mr1700_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419847240 | NA | 5.66E-18 | mr1712_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419847240 | NA | 3.50E-08 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419847240 | NA | 4.00E-11 | mr1756_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419847240 | NA | 1.47E-15 | mr1770_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419847240 | NA | 2.18E-07 | mr1804_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419847240 | NA | 6.16E-16 | mr1836_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419847240 | NA | 3.57E-06 | mr1915_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419847240 | NA | 1.38E-10 | mr1946_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419847240 | 7.62E-06 | 3.85E-07 | mr1946_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419847240 | NA | 1.38E-10 | mr1948_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419847240 | 7.62E-06 | 3.85E-07 | mr1948_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419847240 | NA | 5.15E-06 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419847240 | 2.11E-06 | 1.22E-07 | mr1977_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |