Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419845943:

Variant ID: vg0419845943 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 19845943
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATTCTGACAGGAATGTAAGTGTAAAACAGAGGATTGCAAAACACAGAAAAAATATTGGAATGACTGTTTGATTGGACCACAGGAAAAACACAAAAATTT[G/T]
AGAAGAGATAAAGACTCAAAGGATTTTTTCCATGAGGTTCTACCTCTTGTTAAAATTCCTCCAAAACTTATATCGGAAGAGGCATTCTATAGGAATTTCA

Reverse complement sequence

TGAAATTCCTATAGAATGCCTCTTCCGATATAAGTTTTGGAGGAATTTTAACAAGAGGTAGAACCTCATGGAAAAAATCCTTTGAGTCTTTATCTCTTCT[C/A]
AAATTTTTGTGTTTTTCCTGTGGTCCAATCAAACAGTCATTCCAATATTTTTTCTGTGTTTTGCAATCCTCTGTTTTACACTTACATTCCTGTCAGAATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	44.40%	26.20%	17.18%	12.25%	NA
All Indica	2759	47.60%	5.60%	26.46%	20.37%	NA
All Japonica	1512	36.80%	63.10%	0.07%	0.07%	NA
Aus	269	65.10%	5.20%	24.91%	4.83%	NA
Indica I	595	23.00%	4.90%	45.21%	26.89%	NA
Indica II	465	46.20%	8.40%	25.16%	20.22%	NA
Indica III	913	62.10%	2.70%	16.87%	18.29%	NA
Indica Intermediate	786	50.00%	7.90%	24.17%	17.94%	NA
Temperate Japonica	767	65.30%	34.60%	0.13%	0.00%	NA
Tropical Japonica	504	1.60%	98.20%	0.00%	0.20%	NA
Japonica Intermediate	241	19.50%	80.50%	0.00%	0.00%	NA
VI/Aromatic	96	27.10%	71.90%	1.04%	0.00%	NA
Intermediate	90	30.00%	52.20%	14.44%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0419845943	G -> DEL	N	N	silent_mutation	Average:32.726; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg0419845943	G -> T	LOC_Os04g32860.1	upstream_gene_variant ; 1667.0bp to feature; MODIFIER	silent_mutation	Average:32.726; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg0419845943	G -> T	LOC_Os04g32870.1	upstream_gene_variant ; 3175.0bp to feature; MODIFIER	silent_mutation	Average:32.726; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg0419845943	G -> T	LOC_Os04g32860-LOC_Os04g32870	intergenic_region ; MODIFIER	silent_mutation	Average:32.726; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0419845943	NA	3.94E-06	mr1026	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943	NA	1.05E-08	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943	NA	5.04E-06	mr1177	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943	NA	3.78E-07	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943	NA	5.76E-06	mr1182	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943	NA	5.06E-09	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943	NA	1.35E-12	mr1205	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943	NA	3.22E-07	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943	4.86E-06	4.86E-06	mr1261	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943	NA	3.87E-06	mr1441	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943	NA	9.72E-09	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943	NA	3.45E-08	mr1514	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943	NA	1.72E-16	mr1521	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943	NA	5.86E-07	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943	NA	8.64E-08	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943	NA	1.84E-06	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943	NA	3.57E-06	mr1763	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943	NA	2.77E-07	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943	NA	7.45E-08	mr1794	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943	NA	1.57E-17	mr1825	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943	NA	7.95E-06	mr1852	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943	NA	4.00E-11	mr1864	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943	NA	2.14E-09	mr1880	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943	NA	9.36E-09	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943	NA	3.54E-08	mr1180_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943	NA	3.42E-06	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943	NA	1.29E-08	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251