\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419845943:

Variant ID: vg0419845943 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 19845943
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATTCTGACAGGAATGTAAGTGTAAAACAGAGGATTGCAAAACACAGAAAAAATATTGGAATGACTGTTTGATTGGACCACAGGAAAAACACAAAAATTT[G/T]
AGAAGAGATAAAGACTCAAAGGATTTTTTCCATGAGGTTCTACCTCTTGTTAAAATTCCTCCAAAACTTATATCGGAAGAGGCATTCTATAGGAATTTCA

Reverse complement sequence

TGAAATTCCTATAGAATGCCTCTTCCGATATAAGTTTTGGAGGAATTTTAACAAGAGGTAGAACCTCATGGAAAAAATCCTTTGAGTCTTTATCTCTTCT[C/A]
AAATTTTTGTGTTTTTCCTGTGGTCCAATCAAACAGTCATTCCAATATTTTTTCTGTGTTTTGCAATCCTCTGTTTTACACTTACATTCCTGTCAGAATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.40% 26.20% 17.18% 12.25% NA
All Indica  2759 47.60% 5.60% 26.46% 20.37% NA
All Japonica  1512 36.80% 63.10% 0.07% 0.07% NA
Aus  269 65.10% 5.20% 24.91% 4.83% NA
Indica I  595 23.00% 4.90% 45.21% 26.89% NA
Indica II  465 46.20% 8.40% 25.16% 20.22% NA
Indica III  913 62.10% 2.70% 16.87% 18.29% NA
Indica Intermediate  786 50.00% 7.90% 24.17% 17.94% NA
Temperate Japonica  767 65.30% 34.60% 0.13% 0.00% NA
Tropical Japonica  504 1.60% 98.20% 0.00% 0.20% NA
Japonica Intermediate  241 19.50% 80.50% 0.00% 0.00% NA
VI/Aromatic  96 27.10% 71.90% 1.04% 0.00% NA
Intermediate  90 30.00% 52.20% 14.44% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0419845943 G -> DEL N N silent_mutation Average:32.726; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0419845943 G -> T LOC_Os04g32860.1 upstream_gene_variant ; 1667.0bp to feature; MODIFIER silent_mutation Average:32.726; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0419845943 G -> T LOC_Os04g32870.1 upstream_gene_variant ; 3175.0bp to feature; MODIFIER silent_mutation Average:32.726; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0419845943 G -> T LOC_Os04g32860-LOC_Os04g32870 intergenic_region ; MODIFIER silent_mutation Average:32.726; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0419845943 NA 3.94E-06 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943 NA 1.05E-08 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943 NA 5.04E-06 mr1177 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943 NA 3.78E-07 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943 NA 5.76E-06 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943 NA 5.06E-09 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943 NA 1.35E-12 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943 NA 3.22E-07 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943 4.86E-06 4.86E-06 mr1261 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943 NA 3.87E-06 mr1441 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943 NA 9.72E-09 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943 NA 3.45E-08 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943 NA 1.72E-16 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943 NA 5.86E-07 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943 NA 8.64E-08 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943 NA 1.84E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943 NA 3.57E-06 mr1763 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943 NA 2.77E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943 NA 7.45E-08 mr1794 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943 NA 1.57E-17 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943 NA 7.95E-06 mr1852 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943 NA 4.00E-11 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943 NA 2.14E-09 mr1880 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943 NA 9.36E-09 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943 NA 3.54E-08 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943 NA 3.42E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845943 NA 1.29E-08 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251