Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419845926:

Variant ID: vg0419845926 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 19845926
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:

GAATAGGAAAAACATAGAATTCTGACAGGAATGTAAGTGTAAAACAGAGGATTGCAAAACACAGAAAAAATATTGGAATGACTGTTTGATTGGACCACAG[G/A]
AAAAACACAAAAATTTGAGAAGAGATAAAGACTCAAAGGATTTTTTCCATGAGGTTCTACCTCTTGTTAAAATTCCTCCAAAACTTATATCGGAAGAGGC

Reverse complement sequence

GCCTCTTCCGATATAAGTTTTGGAGGAATTTTAACAAGAGGTAGAACCTCATGGAAAAAATCCTTTGAGTCTTTATCTCTTCTCAAATTTTTGTGTTTTT[C/T]
CTGTGGTCCAATCAAACAGTCATTCCAATATTTTTTCTGTGTTTTGCAATCCTCTGTTTTACACTTACATTCCTGTCAGAATTCTATGTTTTTCCTATTC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.70%	41.70%	0.55%	0.08%	NA
All Indica	2759	91.20%	8.00%	0.65%	0.11%	NA
All Japonica	1512	0.50%	99.30%	0.13%	0.00%	NA
Aus	269	60.20%	38.70%	1.12%	0.00%	NA
Indica I	595	91.60%	7.60%	0.84%	0.00%	NA
Indica II	465	86.90%	12.00%	0.65%	0.43%	NA
Indica III	913	96.20%	3.40%	0.44%	0.00%	NA
Indica Intermediate	786	87.80%	11.30%	0.76%	0.13%	NA
Temperate Japonica	767	0.40%	99.60%	0.00%	0.00%	NA
Tropical Japonica	504	1.00%	98.80%	0.20%	0.00%	NA
Japonica Intermediate	241	0.00%	99.60%	0.41%	0.00%	NA
VI/Aromatic	96	20.80%	77.10%	2.08%	0.00%	NA
Intermediate	90	21.10%	76.70%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0419845926	G -> DEL	N	N	silent_mutation	Average:36.32; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg0419845926	G -> A	LOC_Os04g32860.1	upstream_gene_variant ; 1650.0bp to feature; MODIFIER	silent_mutation	Average:36.32; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg0419845926	G -> A	LOC_Os04g32870.1	upstream_gene_variant ; 3192.0bp to feature; MODIFIER	silent_mutation	Average:36.32; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg0419845926	G -> A	LOC_Os04g32860-LOC_Os04g32870	intergenic_region ; MODIFIER	silent_mutation	Average:36.32; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0419845926	NA	5.87E-19	mr1165_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845926	NA	2.42E-07	mr1321_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845926	NA	4.71E-06	mr1655_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845926	NA	7.26E-18	mr1712_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845926	NA	7.85E-06	mr1712_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845926	NA	5.57E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845926	NA	2.29E-11	mr1946_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845926	8.96E-07	1.89E-07	mr1946_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845926	NA	2.29E-11	mr1948_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845926	8.96E-07	1.89E-07	mr1948_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845926	NA	4.12E-06	mr1977_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251