\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419845320:

Variant ID: vg0419845320 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 19845320
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCAAGCCAATGAAGCGACTGGAAAAGAGACTATTTCCCCTTATCCTTGATGTTCACTAAATAACAGAGGGAGCATGAGTAGATTATCGTAGGTACATTTC[T/C]
TAAGCGGCGCGTTAAATGATGCAATTTTTTTTGCAAAAACTTTCTTTCTATAATATTTTTCTACAAAAATCAAATAAACCCGATCGATCCATGCGATAAT

Reverse complement sequence

ATTATCGCATGGATCGATCGGGTTTATTTGATTTTTGTAGAAAAATATTATAGAAAGAAAGTTTTTGCAAAAAAAATTGCATCATTTAACGCGCCGCTTA[A/G]
GAAATGTACCTACGATAATCTACTCATGCTCCCTCTGTTATTTAGTGAACATCAAGGATAAGGGGAAATAGTCTCTTTTCCAGTCGCTTCATTGGCTTGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.80% 17.50% 13.48% 27.19% NA
All Indica  2759 8.00% 27.50% 21.89% 42.59% NA
All Japonica  1512 99.50% 0.20% 0.13% 0.20% NA
Aus  269 38.70% 20.80% 8.55% 31.97% NA
Indica I  595 6.70% 21.50% 29.24% 42.52% NA
Indica II  465 12.00% 26.70% 21.51% 39.78% NA
Indica III  913 3.60% 33.80% 15.55% 46.99% NA
Indica Intermediate  786 11.80% 25.10% 23.92% 39.19% NA
Temperate Japonica  767 99.70% 0.10% 0.13% 0.00% NA
Tropical Japonica  504 98.80% 0.40% 0.20% 0.60% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 79.20% 8.30% 2.08% 10.42% NA
Intermediate  90 78.90% 2.20% 6.67% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0419845320 T -> C LOC_Os04g32860.1 upstream_gene_variant ; 1044.0bp to feature; MODIFIER silent_mutation Average:25.999; most accessible tissue: Callus, score: 70.012 N N N N
vg0419845320 T -> C LOC_Os04g32870.1 upstream_gene_variant ; 3798.0bp to feature; MODIFIER silent_mutation Average:25.999; most accessible tissue: Callus, score: 70.012 N N N N
vg0419845320 T -> C LOC_Os04g32860-LOC_Os04g32870 intergenic_region ; MODIFIER silent_mutation Average:25.999; most accessible tissue: Callus, score: 70.012 N N N N
vg0419845320 T -> DEL N N silent_mutation Average:25.999; most accessible tissue: Callus, score: 70.012 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0419845320 NA 5.16E-07 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845320 NA 5.47E-08 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845320 NA 5.59E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845320 NA 1.90E-15 mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845320 NA 1.94E-08 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845320 NA 2.78E-06 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845320 2.16E-06 6.85E-07 mr1371_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845320 NA 3.13E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845320 NA 1.54E-18 mr1581_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845320 NA 7.70E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845320 NA 3.57E-06 mr1655_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845320 NA 1.41E-19 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845320 2.66E-07 6.54E-09 mr1712_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845320 NA 8.38E-13 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845320 NA 5.07E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845320 NA 2.11E-13 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845320 NA 8.45E-17 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845320 NA 3.39E-10 mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845320 5.95E-06 3.79E-07 mr1946_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845320 NA 3.39E-10 mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845320 5.95E-06 3.79E-07 mr1948_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845320 4.12E-06 9.37E-07 mr1977_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251