Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419841239:

Variant ID: vg0419841239 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 19841239
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.06, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

AGTATAATGATACCTACAAGTCCACCAAAATTCATGTTCAAATTCGATCTACACATCGAGAAACAAAAAAGACAAATTTAGATATAAACAGTATACTATT[T/C]
ATACGCTGAATTTGTCTTTTTTATATCTCGACGTGTGAGTTGAGTTTGGACTTAAGATTTTGTGGAGTTGCATATATGTGTTGTATGGATGTTGTCAAAT

Reverse complement sequence

ATTTGACAACATCCATACAACACATATATGCAACTCCACAAAATCTTAAGTCCAAACTCAACTCACACGTCGAGATATAAAAAAGACAAATTCAGCGTAT[A/G]
AATAGTATACTGTTTATATCTAAATTTGTCTTTTTTGTTTCTCGATGTGTAGATCGAATTTGAACATGAATTTTGGTGGACTTGTAGGTATCATTATACT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.40%	38.30%	0.23%	0.00%	NA
All Indica	2759	93.00%	6.90%	0.14%	0.00%	NA
All Japonica	1512	1.60%	98.10%	0.33%	0.00%	NA
Aus	269	96.70%	3.00%	0.37%	0.00%	NA
Indica I	595	93.30%	6.20%	0.50%	0.00%	NA
Indica II	465	88.80%	11.20%	0.00%	0.00%	NA
Indica III	913	97.20%	2.80%	0.00%	0.00%	NA
Indica Intermediate	786	90.30%	9.50%	0.13%	0.00%	NA
Temperate Japonica	767	2.30%	97.00%	0.65%	0.00%	NA
Tropical Japonica	504	0.80%	99.20%	0.00%	0.00%	NA
Japonica Intermediate	241	0.80%	99.20%	0.00%	0.00%	NA
VI/Aromatic	96	28.10%	71.90%	0.00%	0.00%	NA
Intermediate	90	30.00%	68.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0419841239	T -> C	LOC_Os04g32850.1	upstream_gene_variant ; 4347.0bp to feature; MODIFIER	silent_mutation	Average:41.583; most accessible tissue: Callus, score: 65.166	N	N	N	N
vg0419841239	T -> C	LOC_Os04g32850.3	upstream_gene_variant ; 4938.0bp to feature; MODIFIER	silent_mutation	Average:41.583; most accessible tissue: Callus, score: 65.166	N	N	N	N
vg0419841239	T -> C	LOC_Os04g32850.2	upstream_gene_variant ; 4368.0bp to feature; MODIFIER	silent_mutation	Average:41.583; most accessible tissue: Callus, score: 65.166	N	N	N	N
vg0419841239	T -> C	LOC_Os04g32860.1	downstream_gene_variant ; 326.0bp to feature; MODIFIER	silent_mutation	Average:41.583; most accessible tissue: Callus, score: 65.166	N	N	N	N
vg0419841239	T -> C	LOC_Os04g32850-LOC_Os04g32860	intergenic_region ; MODIFIER	silent_mutation	Average:41.583; most accessible tissue: Callus, score: 65.166	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0419841239	NA	1.12E-28	mr1130	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239	NA	2.94E-08	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239	NA	2.93E-06	mr1371_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239	NA	1.65E-10	mr1537_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239	NA	3.40E-17	mr1592_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239	NA	3.42E-29	mr1631_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239	NA	3.08E-08	mr1645_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239	NA	2.53E-19	mr1657_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239	NA	4.96E-08	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239	NA	3.60E-20	mr1712_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239	2.57E-07	4.35E-09	mr1712_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239	NA	3.29E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239	NA	2.90E-10	mr1756_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239	NA	1.01E-12	mr1770_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239	NA	4.50E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239	NA	5.33E-50	mr1861_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239	NA	1.15E-18	mr1874_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239	NA	3.11E-06	mr1915_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239	NA	4.04E-09	mr1946_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239	NA	1.64E-06	mr1946_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239	NA	4.04E-09	mr1948_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239	NA	1.64E-06	mr1948_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239	NA	3.21E-06	mr1977_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251