\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419841239:

Variant ID: vg0419841239 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 19841239
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.06, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


AGTATAATGATACCTACAAGTCCACCAAAATTCATGTTCAAATTCGATCTACACATCGAGAAACAAAAAAGACAAATTTAGATATAAACAGTATACTATT[T/C]
ATACGCTGAATTTGTCTTTTTTATATCTCGACGTGTGAGTTGAGTTTGGACTTAAGATTTTGTGGAGTTGCATATATGTGTTGTATGGATGTTGTCAAAT

Reverse complement sequence

ATTTGACAACATCCATACAACACATATATGCAACTCCACAAAATCTTAAGTCCAAACTCAACTCACACGTCGAGATATAAAAAAGACAAATTCAGCGTAT[A/G]
AATAGTATACTGTTTATATCTAAATTTGTCTTTTTTGTTTCTCGATGTGTAGATCGAATTTGAACATGAATTTTGGTGGACTTGTAGGTATCATTATACT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.40% 38.30% 0.23% 0.00% NA
All Indica  2759 93.00% 6.90% 0.14% 0.00% NA
All Japonica  1512 1.60% 98.10% 0.33% 0.00% NA
Aus  269 96.70% 3.00% 0.37% 0.00% NA
Indica I  595 93.30% 6.20% 0.50% 0.00% NA
Indica II  465 88.80% 11.20% 0.00% 0.00% NA
Indica III  913 97.20% 2.80% 0.00% 0.00% NA
Indica Intermediate  786 90.30% 9.50% 0.13% 0.00% NA
Temperate Japonica  767 2.30% 97.00% 0.65% 0.00% NA
Tropical Japonica  504 0.80% 99.20% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 28.10% 71.90% 0.00% 0.00% NA
Intermediate  90 30.00% 68.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0419841239 T -> C LOC_Os04g32850.1 upstream_gene_variant ; 4347.0bp to feature; MODIFIER silent_mutation Average:41.583; most accessible tissue: Callus, score: 65.166 N N N N
vg0419841239 T -> C LOC_Os04g32850.3 upstream_gene_variant ; 4938.0bp to feature; MODIFIER silent_mutation Average:41.583; most accessible tissue: Callus, score: 65.166 N N N N
vg0419841239 T -> C LOC_Os04g32850.2 upstream_gene_variant ; 4368.0bp to feature; MODIFIER silent_mutation Average:41.583; most accessible tissue: Callus, score: 65.166 N N N N
vg0419841239 T -> C LOC_Os04g32860.1 downstream_gene_variant ; 326.0bp to feature; MODIFIER silent_mutation Average:41.583; most accessible tissue: Callus, score: 65.166 N N N N
vg0419841239 T -> C LOC_Os04g32850-LOC_Os04g32860 intergenic_region ; MODIFIER silent_mutation Average:41.583; most accessible tissue: Callus, score: 65.166 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0419841239 NA 1.12E-28 mr1130 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239 NA 2.94E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239 NA 2.93E-06 mr1371_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239 NA 1.65E-10 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239 NA 3.40E-17 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239 NA 3.42E-29 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239 NA 3.08E-08 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239 NA 2.53E-19 mr1657_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239 NA 4.96E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239 NA 3.60E-20 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239 2.57E-07 4.35E-09 mr1712_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239 NA 3.29E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239 NA 2.90E-10 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239 NA 1.01E-12 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239 NA 4.50E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239 NA 5.33E-50 mr1861_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239 NA 1.15E-18 mr1874_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239 NA 3.11E-06 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239 NA 4.04E-09 mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239 NA 1.64E-06 mr1946_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239 NA 4.04E-09 mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239 NA 1.64E-06 mr1948_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419841239 NA 3.21E-06 mr1977_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251