\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419828791:

Variant ID: vg0419828791 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 19828791
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.62, T: 0.39, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:


CCCATTTCGTATTATAAGTCATTTGATTTTTTTCCTAATCGAACTTTATTTAAATTTGACCAAATTTTTTAAAAAAAATACTAACATTTCCAATAAAAAA[T/G]
CATATTGAAAATATATTCGATGAAACTAATTTAGTGTTTTAAATGCTGCTATTTTTTTTATAAATTTAGTCAAATCTAAAGGAATTTAACTAAGAAAAAA

Reverse complement sequence

TTTTTTCTTAGTTAAATTCCTTTAGATTTGACTAAATTTATAAAAAAAATAGCAGCATTTAAAACACTAAATTAGTTTCATCGAATATATTTTCAATATG[A/C]
TTTTTTATTGGAAATGTTAGTATTTTTTTTAAAAAATTTGGTCAAATTTAAATAAAGTTCGATTAGGAAAAAAATCAAATGACTTATAATACGAAATGGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.90% 35.70% 0.21% 16.17% NA
All Indica  2759 66.10% 6.30% 0.22% 27.36% NA
All Japonica  1512 7.80% 91.90% 0.07% 0.20% NA
Aus  269 96.70% 3.00% 0.37% 0.00% NA
Indica I  595 89.20% 4.40% 0.00% 6.39% NA
Indica II  465 58.10% 11.40% 0.43% 30.11% NA
Indica III  913 58.60% 3.10% 0.22% 38.12% NA
Indica Intermediate  786 62.00% 8.70% 0.25% 29.13% NA
Temperate Japonica  767 14.90% 85.10% 0.00% 0.00% NA
Tropical Japonica  504 0.40% 99.00% 0.00% 0.60% NA
Japonica Intermediate  241 0.80% 98.80% 0.41% 0.00% NA
VI/Aromatic  96 37.50% 59.40% 1.04% 2.08% NA
Intermediate  90 32.20% 62.20% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0419828791 T -> DEL N N silent_mutation Average:54.016; most accessible tissue: Callus, score: 91.939 N N N N
vg0419828791 T -> G LOC_Os04g32840.1 upstream_gene_variant ; 889.0bp to feature; MODIFIER silent_mutation Average:54.016; most accessible tissue: Callus, score: 91.939 N N N N
vg0419828791 T -> G LOC_Os04g32840-LOC_Os04g32850 intergenic_region ; MODIFIER silent_mutation Average:54.016; most accessible tissue: Callus, score: 91.939 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0419828791 NA 1.70E-26 mr1130 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419828791 NA 1.10E-06 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419828791 7.91E-06 2.19E-06 mr1371_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419828791 NA 9.91E-06 mr1371_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419828791 NA 6.67E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419828791 NA 3.65E-29 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419828791 NA 6.80E-08 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419828791 NA 7.82E-19 mr1657_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419828791 NA 6.54E-21 mr1712_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419828791 NA 1.45E-06 mr1712_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419828791 NA 6.86E-14 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419828791 NA 4.65E-10 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419828791 NA 1.46E-12 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419828791 NA 1.99E-20 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419828791 NA 7.49E-11 mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419828791 NA 1.16E-06 mr1946_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419828791 NA 7.49E-11 mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419828791 NA 1.16E-06 mr1948_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419828791 7.64E-06 3.44E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419828791 NA 8.88E-06 mr1977_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251