RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0419828791:

Variant ID: vg0419828791 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 19828791
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.62, T: 0.39, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:

CCCATTTCGTATTATAAGTCATTTGATTTTTTTCCTAATCGAACTTTATTTAAATTTGACCAAATTTTTTAAAAAAAATACTAACATTTCCAATAAAAAA[T/G]
CATATTGAAAATATATTCGATGAAACTAATTTAGTGTTTTAAATGCTGCTATTTTTTTTATAAATTTAGTCAAATCTAAAGGAATTTAACTAAGAAAAAA

Reverse complement sequence

TTTTTTCTTAGTTAAATTCCTTTAGATTTGACTAAATTTATAAAAAAAATAGCAGCATTTAAAACACTAAATTAGTTTCATCGAATATATTTTCAATATG[A/C]
TTTTTTATTGGAAATGTTAGTATTTTTTTTAAAAAATTTGGTCAAATTTAAATAAAGTTCGATTAGGAAAAAAATCAAATGACTTATAATACGAAATGGG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.90%	35.70%	0.21%	16.17%	NA
All Indica	2759	66.10%	6.30%	0.22%	27.36%	NA
All Japonica	1512	7.80%	91.90%	0.07%	0.20%	NA
Aus	269	96.70%	3.00%	0.37%	0.00%	NA
Indica I	595	89.20%	4.40%	0.00%	6.39%	NA
Indica II	465	58.10%	11.40%	0.43%	30.11%	NA
Indica III	913	58.60%	3.10%	0.22%	38.12%	NA
Indica Intermediate	786	62.00%	8.70%	0.25%	29.13%	NA
Temperate Japonica	767	14.90%	85.10%	0.00%	0.00%	NA
Tropical Japonica	504	0.40%	99.00%	0.00%	0.60%	NA
Japonica Intermediate	241	0.80%	98.80%	0.41%	0.00%	NA
VI/Aromatic	96	37.50%	59.40%	1.04%	2.08%	NA
Intermediate	90	32.20%	62.20%	1.11%	4.44%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0419828791	T -> DEL	N	N	silent_mutation	Average:54.016; most accessible tissue: Callus, score: 91.939	N	N	N	N
vg0419828791	T -> G	LOC_Os04g32840.1	upstream_gene_variant ; 889.0bp to feature; MODIFIER	silent_mutation	Average:54.016; most accessible tissue: Callus, score: 91.939	N	N	N	N
vg0419828791	T -> G	LOC_Os04g32840-LOC_Os04g32850	intergenic_region ; MODIFIER	silent_mutation	Average:54.016; most accessible tissue: Callus, score: 91.939	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0419828791	NA	1.70E-26	mr1130	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419828791	NA	1.10E-06	mr1979	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419828791	7.91E-06	2.19E-06	mr1371_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419828791	NA	9.91E-06	mr1371_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419828791	NA	6.67E-07	mr1568_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419828791	NA	3.65E-29	mr1631_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419828791	NA	6.80E-08	mr1645_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419828791	NA	7.82E-19	mr1657_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419828791	NA	6.54E-21	mr1712_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419828791	NA	1.45E-06	mr1712_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 20 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0419828791:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact