\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419794296:

Variant ID: vg0419794296 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 19794296
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCGTTCTAAAATATATACTGCCTCTATCCTATAATATAAGACACGGTCAAAGTTGACATGTCTCTAAAACTAATCTTTAACTTATAACTTCTCATATAC[T/A]
ATAAGATTTGTAGCAATAATATTATAACCATATCATATGAAAGTAAATTTAAATGTCAGTCTAATGATATAATTTTTAACAAATAAAATTCATTTCATAT

Reverse complement sequence

ATATGAAATGAATTTTATTTGTTAAAAATTATATCATTAGACTGACATTTAAATTTACTTTCATATGATATGGTTATAATATTATTGCTACAAATCTTAT[A/T]
GTATATGAGAAGTTATAAGTTAAAGATTAGTTTTAGAGACATGTCAACTTTGACCGTGTCTTATATTATAGGATAGAGGCAGTATATATTTTAGAACGAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.30% 6.50% 1.71% 4.42% NA
All Indica  2759 94.30% 0.10% 1.85% 3.77% NA
All Japonica  1512 80.20% 19.50% 0.33% 0.00% NA
Aus  269 61.70% 0.00% 8.92% 29.37% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.30% 0.20% 0.00% 1.51% NA
Indica III  913 89.50% 0.10% 4.93% 5.48% NA
Indica Intermediate  786 93.10% 0.10% 0.76% 5.98% NA
Temperate Japonica  767 66.20% 33.20% 0.52% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 83.40% 16.20% 0.41% 0.00% NA
VI/Aromatic  96 74.00% 0.00% 0.00% 26.04% NA
Intermediate  90 85.60% 12.20% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0419794296 T -> DEL N N silent_mutation Average:72.077; most accessible tissue: Minghui63 young leaf, score: 91.206 N N N N
vg0419794296 T -> A LOC_Os04g32790.1 downstream_gene_variant ; 2461.0bp to feature; MODIFIER silent_mutation Average:72.077; most accessible tissue: Minghui63 young leaf, score: 91.206 N N N N
vg0419794296 T -> A LOC_Os04g32800.1 downstream_gene_variant ; 1974.0bp to feature; MODIFIER silent_mutation Average:72.077; most accessible tissue: Minghui63 young leaf, score: 91.206 N N N N
vg0419794296 T -> A LOC_Os04g32790-LOC_Os04g32800 intergenic_region ; MODIFIER silent_mutation Average:72.077; most accessible tissue: Minghui63 young leaf, score: 91.206 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0419794296 T A -0.05 -0.06 -0.04 -0.02 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0419794296 NA 2.73E-06 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419794296 8.83E-07 6.67E-09 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419794296 NA 1.40E-07 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419794296 NA 5.46E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419794296 NA 6.07E-08 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419794296 NA 4.93E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419794296 NA 3.16E-06 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419794296 NA 6.58E-08 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419794296 NA 3.10E-07 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419794296 NA 3.97E-06 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419794296 1.27E-09 8.29E-13 mr1829_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419794296 NA 1.66E-09 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419794296 NA 3.71E-08 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419794296 2.29E-07 2.18E-15 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419794296 NA 1.34E-08 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251