\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419787605:

Variant ID: vg0419787605 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 19787605
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGAGCAGTCACTGTTTAAGAAAACTACCGTAATTAAGTTATTCTAATGAAATATACTTTCAAATCTTGCAATAATATAAGTTGTAATATAATTCTACAA[T/C]
AGCTATATACTATAAGTATAATATGTATAACTTATATCTAAGTATTAATTTAAAAATATACACTTTCATATCTAAGTTATATATTTATATAGAGATTGTA

Reverse complement sequence

TACAATCTCTATATAAATATATAACTTAGATATGAAAGTGTATATTTTTAAATTAATACTTAGATATAAGTTATACATATTATACTTATAGTATATAGCT[A/G]
TTGTAGAATTATATTACAACTTATATTATTGCAAGATTTGAAAGTATATTTCATTAGAATAACTTAATTACGGTAGTTTTCTTAAACAGTGACTGCTCTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.00% 2.30% 1.78% 0.00% NA
All Indica  2759 99.10% 0.50% 0.40% 0.00% NA
All Japonica  1512 89.40% 6.00% 4.63% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 96.80% 1.50% 1.68% 0.00% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.50% 0.00% 0.00% NA
Temperate Japonica  767 88.40% 5.90% 5.74% 0.00% NA
Tropical Japonica  504 97.80% 0.80% 1.39% 0.00% NA
Japonica Intermediate  241 75.10% 17.00% 7.88% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 4.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0419787605 T -> C LOC_Os04g32790.1 upstream_gene_variant ; 2819.0bp to feature; MODIFIER silent_mutation Average:48.398; most accessible tissue: Zhenshan97 root, score: 76.749 N N N N
vg0419787605 T -> C LOC_Os04g32780-LOC_Os04g32790 intergenic_region ; MODIFIER silent_mutation Average:48.398; most accessible tissue: Zhenshan97 root, score: 76.749 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0419787605 NA 3.82E-09 mr1280 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419787605 NA 2.98E-07 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419787605 NA 4.28E-07 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419787605 NA 2.03E-06 mr1807 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419787605 NA 3.24E-07 mr1318_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419787605 NA 3.40E-06 mr1531_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419787605 NA 4.03E-07 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419787605 NA 2.23E-07 mr1702_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419787605 NA 1.06E-06 mr1707_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419787605 NA 1.49E-07 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419787605 NA 2.17E-06 mr1813_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251