Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419787605:

Variant ID: vg0419787605 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 19787605
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAGAGCAGTCACTGTTTAAGAAAACTACCGTAATTAAGTTATTCTAATGAAATATACTTTCAAATCTTGCAATAATATAAGTTGTAATATAATTCTACAA[T/C]
AGCTATATACTATAAGTATAATATGTATAACTTATATCTAAGTATTAATTTAAAAATATACACTTTCATATCTAAGTTATATATTTATATAGAGATTGTA

Reverse complement sequence

TACAATCTCTATATAAATATATAACTTAGATATGAAAGTGTATATTTTTAAATTAATACTTAGATATAAGTTATACATATTATACTTATAGTATATAGCT[A/G]
TTGTAGAATTATATTACAACTTATATTATTGCAAGATTTGAAAGTATATTTCATTAGAATAACTTAATTACGGTAGTTTTCTTAAACAGTGACTGCTCTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.00%	2.30%	1.78%	0.00%	NA
All Indica	2759	99.10%	0.50%	0.40%	0.00%	NA
All Japonica	1512	89.40%	6.00%	4.63%	0.00%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	96.80%	1.50%	1.68%	0.00%	NA
Indica II	465	99.80%	0.00%	0.22%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.50%	0.50%	0.00%	0.00%	NA
Temperate Japonica	767	88.40%	5.90%	5.74%	0.00%	NA
Tropical Japonica	504	97.80%	0.80%	1.39%	0.00%	NA
Japonica Intermediate	241	75.10%	17.00%	7.88%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	4.40%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0419787605	T -> C	LOC_Os04g32790.1	upstream_gene_variant ; 2819.0bp to feature; MODIFIER	silent_mutation	Average:48.398; most accessible tissue: Zhenshan97 root, score: 76.749	N	N	N	N
vg0419787605	T -> C	LOC_Os04g32780-LOC_Os04g32790	intergenic_region ; MODIFIER	silent_mutation	Average:48.398; most accessible tissue: Zhenshan97 root, score: 76.749	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0419787605	NA	3.82E-09	mr1280	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419787605	NA	2.98E-07	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419787605	NA	4.28E-07	mr1788	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419787605	NA	2.03E-06	mr1807	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419787605	NA	3.24E-07	mr1318_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419787605	NA	3.40E-06	mr1531_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419787605	NA	4.03E-07	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419787605	NA	2.23E-07	mr1702_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419787605	NA	1.06E-06	mr1707_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419787605	NA	1.49E-07	mr1788_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419787605	NA	2.17E-06	mr1813_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251