\
| Variant ID: vg0419784082 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 19784082 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGGCTTAATAAATTCGTCTCGCGGTTTACTGACGGATTCTGTAATTAGTTTTTTTATTAGTATCCGAACACCCTATGCGACACTCTATATATATATACCA[C/T]
ATGTAACACGCCAAAACTTTACACCCTTGGATCTAAACACCCCAGCACCCCATGGCAGCACAGTTATCATCTGACTGATCATTATCTGCAGGTTGACCAT
ATGGTCAACCTGCAGATAATGATCAGTCAGATGATAACTGTGCTGCCATGGGGTGCTGGGGTGTTTAGATCCAAGGGTGTAAAGTTTTGGCGTGTTACAT[G/A]
TGGTATATATATATAGAGTGTCGCATAGGGTGTTCGGATACTAATAAAAAAACTAATTACAGAATCCGTCAGTAAACCGCGAGACGAATTTATTAAGCCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.10% | 36.40% | 0.49% | 0.00% | NA |
| All Indica | 2759 | 94.10% | 5.70% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 14.90% | 84.30% | 0.73% | 0.00% | NA |
| Aus | 269 | 40.50% | 58.40% | 1.12% | 0.00% | NA |
| Indica I | 595 | 93.30% | 6.40% | 0.34% | 0.00% | NA |
| Indica II | 465 | 94.40% | 4.70% | 0.86% | 0.00% | NA |
| Indica III | 913 | 95.70% | 4.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 22.20% | 76.80% | 1.04% | 0.00% | NA |
| Tropical Japonica | 504 | 2.20% | 97.60% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 18.70% | 80.50% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 22.90% | 77.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 30.00% | 66.70% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0419784082 | C -> T | LOC_Os04g32780-LOC_Os04g32790 | intergenic_region ; MODIFIER | silent_mutation | Average:56.492; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0419784082 | NA | 1.10E-08 | mr1047 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419784082 | NA | 7.35E-10 | mr1151 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419784082 | NA | 5.08E-18 | mr1164 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419784082 | NA | 3.09E-08 | mr1174 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419784082 | NA | 1.12E-14 | mr1261 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419784082 | NA | 7.75E-06 | mr1450 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419784082 | NA | 1.91E-20 | mr1580 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419784082 | NA | 2.53E-20 | mr1627 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419784082 | NA | 1.80E-06 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419784082 | NA | 6.10E-20 | mr1825 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419784082 | NA | 9.38E-07 | mr1321_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419784082 | NA | 1.55E-12 | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |